Incidental Mutation 'R0648:Mtbp'
ID57373
Institutional Source Beutler Lab
Gene Symbol Mtbp
Ensembl Gene ENSMUSG00000022369
Gene NameMdm2, transformed 3T3 cell double minute p53 binding protein
SynonymsMDM2BP
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0648 (G1)
Quality Score120
Status Validated
Chromosome15
Chromosomal Location55557408-55626423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55603201 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 537 (P537S)
Ref Sequence ENSEMBL: ENSMUSP00000129396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022998] [ENSMUST00000169667] [ENSMUST00000170046]
Predicted Effect probably benign
Transcript: ENSMUST00000022998
AA Change: P537S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022998
Gene: ENSMUSG00000022369
AA Change: P537S

DomainStartEndE-ValueType
Pfam:MTBP_N 1 270 1.2e-116 PFAM
Pfam:MTBP_mid 287 626 1.4e-161 PFAM
Pfam:MTBP_C 630 884 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169667
AA Change: P164S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128615
Gene: ENSMUSG00000022369
AA Change: P164S

DomainStartEndE-ValueType
Pfam:MTBP_mid 1 253 2.3e-119 PFAM
Pfam:MTBP_C 257 511 2.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170046
AA Change: P537S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129396
Gene: ENSMUSG00000022369
AA Change: P537S

DomainStartEndE-ValueType
Pfam:MTBP_N 1 276 3.4e-145 PFAM
Pfam:MTBP_mid 286 626 3.1e-171 PFAM
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality; interestingly, heterozygous mice are not tumor prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Mtbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Mtbp APN 15 55617508 nonsense probably null
IGL00988:Mtbp APN 15 55558498 unclassified probably benign
IGL01608:Mtbp APN 15 55557689 nonsense probably null
IGL02422:Mtbp APN 15 55563043 missense possibly damaging 0.59
IGL02664:Mtbp APN 15 55619643 missense probably benign 0.01
IGL03160:Mtbp APN 15 55620617 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0280:Mtbp UTSW 15 55586461 missense probably benign 0.04
R0302:Mtbp UTSW 15 55625424 missense probably damaging 0.99
R0387:Mtbp UTSW 15 55611029 missense possibly damaging 0.82
R0402:Mtbp UTSW 15 55569070 nonsense probably null
R0735:Mtbp UTSW 15 55562942 nonsense probably null
R0845:Mtbp UTSW 15 55563090 critical splice donor site probably null
R1186:Mtbp UTSW 15 55564671 missense probably null 1.00
R1398:Mtbp UTSW 15 55577537 nonsense probably null
R1500:Mtbp UTSW 15 55617555 missense probably damaging 0.99
R1712:Mtbp UTSW 15 55571294 critical splice acceptor site probably null
R1893:Mtbp UTSW 15 55557668 missense probably benign 0.37
R1902:Mtbp UTSW 15 55606715 missense probably damaging 0.99
R1917:Mtbp UTSW 15 55564677 splice site probably benign
R2267:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2268:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2269:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2383:Mtbp UTSW 15 55566194 missense probably damaging 1.00
R2512:Mtbp UTSW 15 55577536 missense probably damaging 0.98
R2924:Mtbp UTSW 15 55619814 missense probably benign 0.21
R2925:Mtbp UTSW 15 55619814 missense probably benign 0.21
R4164:Mtbp UTSW 15 55609521 missense probably benign
R4232:Mtbp UTSW 15 55620677 nonsense probably null
R4255:Mtbp UTSW 15 55620685 missense possibly damaging 0.66
R4438:Mtbp UTSW 15 55603215 missense probably benign 0.41
R5009:Mtbp UTSW 15 55603187 missense probably benign
R5132:Mtbp UTSW 15 55558569 missense possibly damaging 0.92
R5685:Mtbp UTSW 15 55562772 missense probably damaging 1.00
R5933:Mtbp UTSW 15 55571327 missense possibly damaging 0.92
R6377:Mtbp UTSW 15 55557620 start codon destroyed probably null 0.32
R6554:Mtbp UTSW 15 55567249 missense probably damaging 0.99
R6811:Mtbp UTSW 15 55606546 intron probably null
R6942:Mtbp UTSW 15 55567200 missense probably damaging 0.99
R7134:Mtbp UTSW 15 55558565 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATAGTGAACTTGTGCCTTTGTTCCAC -3'
(R):5'- GGCAGATGACCTTCCCCTTTTAATGG -3'

Sequencing Primer
(F):5'- Tacacacacacacacacacac -3'
(R):5'- CTTTTAATGGACATGCTACTCTACTG -3'
Posted On2013-07-11