Incidental Mutation 'R0648:Gnl1'
ID57381
Institutional Source Beutler Lab
Gene Symbol Gnl1
Ensembl Gene ENSMUSG00000024429
Gene Nameguanine nucleotide binding protein-like 1
SynonymsGnal1, Gna-rs1
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0648 (G1)
Quality Score212
Status Validated
Chromosome17
Chromosomal Location35979851-35989462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35982598 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 225 (N225S)
Ref Sequence ENSEMBL: ENSMUSP00000084450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055454] [ENSMUST00000087200] [ENSMUST00000165613] [ENSMUST00000172429] [ENSMUST00000172900] [ENSMUST00000173585] [ENSMUST00000173724] [ENSMUST00000173872] [ENSMUST00000174849]
Predicted Effect probably benign
Transcript: ENSMUST00000055454
SMART Domains Protein: ENSMUSP00000052166
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
low complexity region 110 120 N/A INTRINSIC
ZnF_C3H1 158 184 3.04e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087200
AA Change: N225S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084450
Gene: ENSMUSG00000024429
AA Change: N225S

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
SCOP:d1egaa1 179 232 6e-3 SMART
Pfam:MMR_HSR1 362 465 1.4e-13 PFAM
low complexity region 550 583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165613
SMART Domains Protein: ENSMUSP00000125802
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172429
SMART Domains Protein: ENSMUSP00000129651
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172900
SMART Domains Protein: ENSMUSP00000134115
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173417
Predicted Effect probably benign
Transcript: ENSMUST00000173585
SMART Domains Protein: ENSMUSP00000134373
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173724
Predicted Effect probably benign
Transcript: ENSMUST00000173872
SMART Domains Protein: ENSMUSP00000134021
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174275
Predicted Effect probably benign
Transcript: ENSMUST00000174849
SMART Domains Protein: ENSMUSP00000134505
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GNL1 gene, identified in the human major histocompatibility complex class I region, shows a high degree of similarity with its mouse counterpart. The GNL1 gene is located less than 2 kb centromeric to HLA-E, in the same transcriptional orientation. GNL1 is telomeric to HLA-B and HLA-C. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Gnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02956:Gnl1 APN 17 35987612 missense probably benign
IGL03325:Gnl1 APN 17 35988656 missense probably damaging 1.00
R1611:Gnl1 UTSW 17 35987549 missense probably damaging 1.00
R1781:Gnl1 UTSW 17 35987746 missense probably damaging 1.00
R1897:Gnl1 UTSW 17 35988692 missense possibly damaging 0.73
R2027:Gnl1 UTSW 17 35982958 missense probably benign
R2240:Gnl1 UTSW 17 35982679 missense probably benign 0.04
R3944:Gnl1 UTSW 17 35988521 missense probably benign 0.09
R4569:Gnl1 UTSW 17 35988250 missense probably benign 0.00
R4849:Gnl1 UTSW 17 35987711 splice site probably null
R4969:Gnl1 UTSW 17 35980689 missense possibly damaging 0.62
R5661:Gnl1 UTSW 17 35982555 missense probably benign 0.13
R5705:Gnl1 UTSW 17 35981600 missense probably benign 0.01
R6372:Gnl1 UTSW 17 35982535 missense probably damaging 1.00
R6520:Gnl1 UTSW 17 35982953 missense probably benign 0.17
R6919:Gnl1 UTSW 17 35987533 nonsense probably null
R7022:Gnl1 UTSW 17 35988728 missense probably damaging 1.00
R7323:Gnl1 UTSW 17 35983413 missense probably benign 0.01
X0027:Gnl1 UTSW 17 35987801 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATCTACTTCTGCCAGAGCTGTGCC -3'
(R):5'- GAAGATGTGCCTCTTTCTCCTGCTG -3'

Sequencing Primer
(F):5'- AGAGCTGTGCCTGGTGAC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-07-11