Incidental Mutation 'R0625:Itih2'
ID57392
Institutional Source Beutler Lab
Gene Symbol Itih2
Ensembl Gene ENSMUSG00000037254
Gene Nameinter-alpha trypsin inhibitor, heavy chain 2
SynonymsItih-2, Intin2
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0625 (G1)
Quality Score129
Status Not validated
Chromosome2
Chromosomal Location10094593-10131396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10123414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 159 (V159I)
Ref Sequence ENSEMBL: ENSMUSP00000124636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000155809] [ENSMUST00000161909]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
AA Change: V159I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254
AA Change: V159I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155809
AA Change: V159I

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124636
Gene: ENSMUSG00000037254
AA Change: V159I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 452 4.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161909
SMART Domains Protein: ENSMUSP00000124880
Gene: ENSMUSG00000037254

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:VIT 60 81 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Itih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Itih2 APN 2 10110439 missense probably benign 0.00
IGL01775:Itih2 APN 2 10129286 missense probably benign 0.19
IGL02516:Itih2 APN 2 10097917 missense probably benign 0.00
IGL02698:Itih2 APN 2 10130501 missense probably damaging 1.00
IGL02747:Itih2 APN 2 10097945 missense probably benign 0.35
IGL03162:Itih2 APN 2 10126244 missense probably damaging 1.00
IGL03325:Itih2 APN 2 10106735 missense probably damaging 1.00
R0226:Itih2 UTSW 2 10115299 missense possibly damaging 0.71
R0316:Itih2 UTSW 2 10105246 missense possibly damaging 0.67
R0415:Itih2 UTSW 2 10105615 unclassified probably benign
R0612:Itih2 UTSW 2 10117394 missense probably benign 0.16
R0766:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1312:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1322:Itih2 UTSW 2 10109522 missense probably damaging 1.00
R1521:Itih2 UTSW 2 10106747 missense probably damaging 1.00
R1544:Itih2 UTSW 2 10105214 missense probably benign 0.27
R1622:Itih2 UTSW 2 10102079 missense probably benign 0.00
R1649:Itih2 UTSW 2 10105735 missense probably benign 0.37
R2064:Itih2 UTSW 2 10130574 missense possibly damaging 0.83
R2378:Itih2 UTSW 2 10094887 missense probably damaging 1.00
R2893:Itih2 UTSW 2 10102197 missense possibly damaging 0.79
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3733:Itih2 UTSW 2 10105670 missense probably benign 0.00
R4195:Itih2 UTSW 2 10115285 missense probably damaging 1.00
R4405:Itih2 UTSW 2 10106737 nonsense probably null
R4585:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4586:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4610:Itih2 UTSW 2 10105160 missense probably damaging 0.96
R5311:Itih2 UTSW 2 10110535 missense probably benign 0.01
R5361:Itih2 UTSW 2 10096461 missense probably benign 0.09
R5436:Itih2 UTSW 2 10105196 missense probably benign 0.00
R5454:Itih2 UTSW 2 10097993 missense probably null 0.00
R5580:Itih2 UTSW 2 10123476 missense probably damaging 1.00
R5621:Itih2 UTSW 2 10102805 missense probably benign 0.00
R5846:Itih2 UTSW 2 10097903 missense probably benign 0.00
R6083:Itih2 UTSW 2 10108894 intron probably benign
R6190:Itih2 UTSW 2 10098507 missense probably benign 0.37
R6198:Itih2 UTSW 2 10098541 missense probably benign 0.00
R6469:Itih2 UTSW 2 10123413 missense possibly damaging 0.65
R6816:Itih2 UTSW 2 10105706 missense probably damaging 1.00
R6820:Itih2 UTSW 2 10098098 missense probably benign 0.00
R6853:Itih2 UTSW 2 10115266 missense probably damaging 1.00
R7102:Itih2 UTSW 2 10105763 missense probably benign 0.27
R7173:Itih2 UTSW 2 10105163 missense probably damaging 1.00
R7387:Itih2 UTSW 2 10130508 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGGGTCTACCTACTTACAAGACAAGTCA -3'
(R):5'- CTCGCTTCCTGCAATTCAAAATGTTCA -3'

Sequencing Primer
(F):5'- CTTTAGGGAAACAGATACTGTGACC -3'
(R):5'- CCTGCAATTCAAAATGTTCATTGCC -3'
Posted On2013-07-11