Incidental Mutation 'R7397:Map3k1'
ID573921
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Namemitogen-activated protein kinase kinase kinase 1
SynonymsMekk, MEKK1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R7397 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location111746428-111808993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111755208 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1171 (A1171V)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267]
Predicted Effect probably damaging
Transcript: ENSMUST00000109267
AA Change: A1171V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: A1171V

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Foxc1 A G 13: 31,807,635 D143G probably damaging Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nlrp10 A G 7: 108,924,692 L527P probably damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r1 T G 17: 65,837,791 I801S probably benign Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rbm6 A G 9: 107,852,519 M310T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vmn2r91 G T 17: 18,135,798 V576L probably benign Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111758189 critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111754662 missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111756243 missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111755525 missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111749025 missense probably benign 0.01
IGL03213:Map3k1 APN 13 111748892 utr 3 prime probably benign
R0005:Map3k1 UTSW 13 111755704 missense probably benign 0.00
R0025:Map3k1 UTSW 13 111756129 missense probably benign
R0506:Map3k1 UTSW 13 111755764 nonsense probably null
R0540:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0607:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0898:Map3k1 UTSW 13 111767956 unclassified probably benign
R1171:Map3k1 UTSW 13 111755643 missense probably benign 0.29
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111757150 missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111755419 missense probably benign 0.23
R1893:Map3k1 UTSW 13 111768033 missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111752482 missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111755788 missense probably benign 0.00
R2239:Map3k1 UTSW 13 111748944 missense probably benign 0.00
R3686:Map3k1 UTSW 13 111753891 missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111756220 missense probably benign 0.00
R4094:Map3k1 UTSW 13 111756162 missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111768494 missense probably benign 0.01
R4902:Map3k1 UTSW 13 111772612 missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111772738 missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111756120 missense probably benign 0.20
R5855:Map3k1 UTSW 13 111755979 missense probably benign 0.37
R6384:Map3k1 UTSW 13 111750530 missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111769441 missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111755725 missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111753829 missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111752449 missense probably benign 0.07
R6900:Map3k1 UTSW 13 111753816 missense probably benign 0.01
R6943:Map3k1 UTSW 13 111772712 missense probably benign 0.30
R6946:Map3k1 UTSW 13 111768501 nonsense probably null
R7059:Map3k1 UTSW 13 111772778 missense probably benign
R7271:Map3k1 UTSW 13 111756697 missense probably benign 0.32
R7290:Map3k1 UTSW 13 111768111 missense probably damaging 1.00
R7457:Map3k1 UTSW 13 111756255 missense probably damaging 0.99
X0065:Map3k1 UTSW 13 111757105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGAGACTCAAAATCATTGC -3'
(R):5'- AGCTCAACTCCAGCATCGAG -3'

Sequencing Primer
(F):5'- ATCATTGCCACATACTTATGCAG -3'
(R):5'- ATCGAGGACCTTCTTGAAGC -3'
Posted On2019-09-13