Incidental Mutation 'R0625:Olfr1104'
ID57393
Institutional Source Beutler Lab
Gene Symbol Olfr1104
Ensembl Gene ENSMUSG00000075166
Gene Nameolfactory receptor 1104
SynonymsGA_x6K02T2Q125-48508763-48507833, MOR207-1
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R0625 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87020703-87027080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87021620 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 308 (H308L)
Ref Sequence ENSEMBL: ENSMUSP00000149240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099869] [ENSMUST00000214857] [ENSMUST00000215972]
Predicted Effect probably benign
Transcript: ENSMUST00000099869
AA Change: H308L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: H308L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.3e-48 PFAM
Pfam:7tm_1 41 289 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214857
AA Change: H308L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215972
AA Change: H308L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Olfr1104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1104 APN 2 87021884 missense probably damaging 1.00
IGL02533:Olfr1104 APN 2 87022353 missense probably damaging 1.00
IGL02662:Olfr1104 APN 2 87022002 missense probably benign 0.09
IGL02704:Olfr1104 APN 2 87022277 missense probably benign 0.00
R0145:Olfr1104 UTSW 2 87021790 nonsense probably null
R1169:Olfr1104 UTSW 2 87021717 missense probably damaging 1.00
R1570:Olfr1104 UTSW 2 87022272 missense probably benign
R1727:Olfr1104 UTSW 2 87022263 missense probably damaging 1.00
R2146:Olfr1104 UTSW 2 87021665 missense probably damaging 1.00
R2192:Olfr1104 UTSW 2 87022511 missense probably benign 0.01
R3716:Olfr1104 UTSW 2 87022363 nonsense probably null
R3818:Olfr1104 UTSW 2 87021710 missense probably benign 0.02
R4711:Olfr1104 UTSW 2 87022026 missense probably damaging 1.00
R6104:Olfr1104 UTSW 2 87021713 missense probably damaging 1.00
R6482:Olfr1104 UTSW 2 87022525 missense probably benign 0.00
R7474:Olfr1104 UTSW 2 87022554 start gained probably benign
X0019:Olfr1104 UTSW 2 87021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGTAAGTCGCATGAAACTGGAACT -3'
(R):5'- CCTCACAGGGGTCACTGTCTTCTATG -3'

Sequencing Primer
(F):5'- aagatcaacagcctgctcc -3'
(R):5'- ATGGCTCTTTGATTTTCACCTATTTG -3'
Posted On2013-07-11