Incidental Mutation 'R0625:Gfra4'
ID57398
Institutional Source Beutler Lab
Gene Symbol Gfra4
Ensembl Gene ENSMUSG00000027316
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 4
SynonymsGFR alpha-4, G630015H18Rik
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0625 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131039632-131043088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131040256 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 277 (V277I)
Ref Sequence ENSEMBL: ENSMUSP00000028787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028787] [ENSMUST00000028787] [ENSMUST00000066958] [ENSMUST00000110234] [ENSMUST00000110235] [ENSMUST00000110239] [ENSMUST00000110240]
Predicted Effect probably null
Transcript: ENSMUST00000028787
AA Change: V277I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028787
Gene: ENSMUSG00000027316
AA Change: V277I

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
GDNF 132 226 1.2e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028787
AA Change: V277I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028787
Gene: ENSMUSG00000027316
AA Change: V277I

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
GDNF 132 226 1.2e-31 SMART
Predicted Effect silent
Transcript: ENSMUST00000066958
SMART Domains Protein: ENSMUSP00000068357
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
GDNF 26 111 6.76e-17 SMART
GDNF 123 217 1.2e-31 SMART
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110234
SMART Domains Protein: ENSMUSP00000105863
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
low complexity region 132 147 N/A INTRINSIC
low complexity region 169 190 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110235
SMART Domains Protein: ENSMUSP00000105864
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GDNF 26 111 6.76e-17 SMART
low complexity region 123 138 N/A INTRINSIC
low complexity region 160 181 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000110239
SMART Domains Protein: ENSMUSP00000105868
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
GDNF 132 226 1.2e-31 SMART
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110240
AA Change: V268I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105869
Gene: ENSMUSG00000027316
AA Change: V268I

DomainStartEndE-ValueType
GDNF 26 111 6.76e-17 SMART
GDNF 123 217 1.2e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184185
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for persephin, a member of the glial cell line derived neurotrophic factors. The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the receptor tyrosine kinase Ret. A complete lack of the encoded protein impairs production of thyroid calcitonin and increases the rate of bone formation in young mice. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations are mice were viable, fertile, showed no overt anatomical defects. Thyroid tissue calcitonin content was reduced in null homozygotes and rate of bone formation was enhanced when in 129/B6 hybrid background strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Gfra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Gfra4 APN 2 131040283 missense possibly damaging 0.82
IGL02966:Gfra4 APN 2 131042640 missense possibly damaging 0.73
R2285:Gfra4 UTSW 2 131041731 missense probably damaging 1.00
R7233:Gfra4 UTSW 2 131041117 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCAGTCAGACCCTAGCCTCCAG -3'
(R):5'- TGACAGCTTGCAGCCATCAGTTC -3'

Sequencing Primer
(F):5'- AGCCCCCAATCCAGAGG -3'
(R):5'- CAGTTTCCGAATCCTTCCCA -3'
Posted On2013-07-11