Incidental Mutation 'R7399:Olfr1170'
ID574006
Institutional Source Beutler Lab
Gene Symbol Olfr1170
Ensembl Gene ENSMUSG00000075133
Gene Nameolfactory receptor 1170
SynonymsGA_x6K02T2Q125-49709783-49708833, MOR174-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7399 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88222098-88228334 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88225022 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 3 (Y3*)
Ref Sequence ENSEMBL: ENSMUSP00000150142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099831] [ENSMUST00000214386]
Predicted Effect probably null
Transcript: ENSMUST00000099831
AA Change: Y3*
SMART Domains Protein: ENSMUSP00000097419
Gene: ENSMUSG00000075133
AA Change: Y3*

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-49 PFAM
Pfam:7tm_1 43 292 4.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214386
AA Change: Y3*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Olfr1170
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0184:Olfr1170 UTSW 2 88224780 nonsense probably null
R0496:Olfr1170 UTSW 2 88224155 nonsense probably null
R0558:Olfr1170 UTSW 2 88224474 missense possibly damaging 0.50
R2067:Olfr1170 UTSW 2 88224474 missense possibly damaging 0.50
R2111:Olfr1170 UTSW 2 88224474 missense possibly damaging 0.50
R2273:Olfr1170 UTSW 2 88224823 missense probably benign 0.03
R2274:Olfr1170 UTSW 2 88224823 missense probably benign 0.03
R2275:Olfr1170 UTSW 2 88224823 missense probably benign 0.03
R5924:Olfr1170 UTSW 2 88224547 missense probably benign
R5942:Olfr1170 UTSW 2 88224572 missense probably benign 0.03
R6487:Olfr1170 UTSW 2 88224526 missense possibly damaging 0.80
X0022:Olfr1170 UTSW 2 88224981 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCAAGATCTGCAAAAGTTTGGG -3'
(R):5'- ACTGCCCACGTAAGAACCTG -3'

Sequencing Primer
(F):5'- CTGCAAAAGTTTGGGTGTAAATACAC -3'
(R):5'- GAACCTGTAACAAGGGCAAATATTC -3'
Posted On2019-09-13