Incidental Mutation 'R0625:Nes'
ID57402
Institutional Source Beutler Lab
Gene Symbol Nes
Ensembl Gene ENSMUSG00000004891
Gene Namenestin
SynonymsESTM46
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R0625 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87971078-87980451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87977172 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 913 (T913A)
Ref Sequence ENSEMBL: ENSMUSP00000088493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090973] [ENSMUST00000160694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090973
AA Change: T913A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088493
Gene: ENSMUSG00000004891
AA Change: T913A

DomainStartEndE-ValueType
Filament 7 313 1.81e-37 SMART
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 470 771 2.37e-7 PROSPERO
internal_repeat_1 614 832 5.41e-11 PROSPERO
internal_repeat_2 851 1174 2.37e-7 PROSPERO
internal_repeat_1 1064 1304 5.41e-11 PROSPERO
low complexity region 1347 1366 N/A INTRINSIC
low complexity region 1426 1438 N/A INTRINSIC
low complexity region 1653 1683 N/A INTRINSIC
low complexity region 1713 1724 N/A INTRINSIC
low complexity region 1741 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159830
Predicted Effect possibly damaging
Transcript: ENSMUST00000160694
AA Change: T869A

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125571
Gene: ENSMUSG00000004891
AA Change: T869A

DomainStartEndE-ValueType
Pfam:Filament 7 313 3.5e-29 PFAM
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 456 672 1.06e-5 PROSPERO
internal_repeat_1 470 798 1.21e-11 PROSPERO
internal_repeat_1 807 1134 1.21e-11 PROSPERO
internal_repeat_2 1024 1213 1.06e-5 PROSPERO
low complexity region 1303 1322 N/A INTRINSIC
low complexity region 1382 1394 N/A INTRINSIC
low complexity region 1609 1639 N/A INTRINSIC
low complexity region 1669 1680 N/A INTRINSIC
low complexity region 1697 1716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a high incidence of embryonic lethality, reduced embryo and birth body size, and fewer neural stem cells and increased apoptosis in the neuroepithelium of the developing neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Nes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Nes APN 3 87976254 nonsense probably null
IGL01532:Nes APN 3 87978347 missense possibly damaging 0.54
IGL01544:Nes APN 3 87977964 missense possibly damaging 0.93
IGL02609:Nes APN 3 87977221 missense probably benign 0.33
IGL02877:Nes APN 3 87975661 missense probably benign 0.04
IGL02937:Nes APN 3 87979879 missense probably benign
R0271:Nes UTSW 3 87978642 missense possibly damaging 0.91
R0587:Nes UTSW 3 87978569 missense probably benign 0.08
R0741:Nes UTSW 3 87978967 missense probably damaging 0.98
R1256:Nes UTSW 3 87976576 missense probably benign
R1630:Nes UTSW 3 87977677 missense probably benign 0.32
R1702:Nes UTSW 3 87975979 missense probably benign 0.04
R1724:Nes UTSW 3 87977441 missense probably benign
R1738:Nes UTSW 3 87976421 nonsense probably null
R1853:Nes UTSW 3 87975807 missense possibly damaging 0.91
R1946:Nes UTSW 3 87978514 missense possibly damaging 0.79
R1971:Nes UTSW 3 87978327 missense possibly damaging 0.81
R2013:Nes UTSW 3 87976678 missense possibly damaging 0.51
R2111:Nes UTSW 3 87977311 missense probably benign 0.04
R2232:Nes UTSW 3 87978931 missense possibly damaging 0.93
R2392:Nes UTSW 3 87975943 missense probably benign 0.08
R3548:Nes UTSW 3 87973122 splice site probably benign
R3937:Nes UTSW 3 87971236 missense probably benign 0.02
R4239:Nes UTSW 3 87979359 missense probably damaging 1.00
R4240:Nes UTSW 3 87979359 missense probably damaging 1.00
R4426:Nes UTSW 3 87976042 missense probably damaging 0.96
R4493:Nes UTSW 3 87976813 missense probably damaging 0.96
R4494:Nes UTSW 3 87976813 missense probably damaging 0.96
R4674:Nes UTSW 3 87971795 missense possibly damaging 0.51
R4772:Nes UTSW 3 87976179 missense probably benign 0.02
R4959:Nes UTSW 3 87975676 missense probably damaging 0.99
R4973:Nes UTSW 3 87975676 missense probably damaging 0.99
R5055:Nes UTSW 3 87977214 missense probably benign
R5207:Nes UTSW 3 87978628 missense probably damaging 1.00
R5289:Nes UTSW 3 87978418 missense probably damaging 0.98
R5420:Nes UTSW 3 87977002 missense probably damaging 0.99
R5424:Nes UTSW 3 87978824 missense possibly damaging 0.94
R5697:Nes UTSW 3 87977848 missense probably damaging 0.96
R5940:Nes UTSW 3 87975952 missense probably damaging 0.99
R6661:Nes UTSW 3 87976936 missense probably damaging 0.96
R6905:Nes UTSW 3 87978678 missense probably damaging 0.99
R7087:Nes UTSW 3 87979758 missense probably benign 0.00
R7356:Nes UTSW 3 87977751 missense possibly damaging 0.93
X0019:Nes UTSW 3 87977418 missense probably benign 0.15
X0062:Nes UTSW 3 87977726 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAAGTCAGGAGTCCCTGAAGTC -3'
(R):5'- GAGGGTTCACTGTCATCTGCTCATC -3'

Sequencing Primer
(F):5'- GAGTCCCTGAAGTCTCCAGAAG -3'
(R):5'- TAGAGACCTCAGGGACTCTAGATTC -3'
Posted On2013-07-11