Incidental Mutation 'R0625:Sorcs2'
ID 57411
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 038814-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0625 (G1)
Quality Score 151
Status Not validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36181916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1068 (D1068V)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: D1068V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: D1068V

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,319,365 (GRCm39) S2P probably benign Het
Abca16 A C 7: 120,035,116 (GRCm39) T301P probably damaging Het
Acer2 A G 4: 86,805,399 (GRCm39) D121G possibly damaging Het
Adgrd1 T C 5: 129,248,995 (GRCm39) probably null Het
Arhgap11a T C 2: 113,672,056 (GRCm39) I249V probably benign Het
Arhgap22 A G 14: 33,088,671 (GRCm39) E219G probably benign Het
C2cd4b T A 9: 67,667,033 (GRCm39) S10T probably benign Het
Cnot6 A T 11: 49,573,998 (GRCm39) I224N probably damaging Het
Ctrc T C 4: 141,568,829 (GRCm39) T125A probably damaging Het
Cxxc5 T G 18: 35,991,642 (GRCm39) S14R unknown Het
Cyp4f37 T G 17: 32,853,652 (GRCm39) F445L probably damaging Het
Dcbld1 T G 10: 52,188,946 (GRCm39) I186S probably benign Het
Dmxl2 T C 9: 54,289,986 (GRCm39) T2510A probably benign Het
Dnah3 A G 7: 119,671,110 (GRCm39) I591T possibly damaging Het
Dock5 A T 14: 68,078,612 (GRCm39) I204N probably benign Het
Dysf G A 6: 84,088,969 (GRCm39) probably null Het
Erich5 A G 15: 34,471,515 (GRCm39) E248G probably damaging Het
Fhip1a A G 3: 85,637,807 (GRCm39) V164A possibly damaging Het
Foxm1 A G 6: 128,350,834 (GRCm39) S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 (GRCm39) T959A probably benign Het
Gfra4 C T 2: 130,882,176 (GRCm39) V277I probably null Het
Hacd4 T C 4: 88,353,247 (GRCm39) I82V probably benign Het
Itih2 C T 2: 10,128,225 (GRCm39) V159I possibly damaging Het
Itpr2 T A 6: 146,068,149 (GRCm39) M2410L probably benign Het
Marchf11 A G 15: 26,311,129 (GRCm39) I202V probably damaging Het
Marchf3 A G 18: 56,944,902 (GRCm39) probably null Het
Med12l G A 3: 59,154,858 (GRCm39) E1135K probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Mlx T C 11: 100,978,608 (GRCm39) L78P possibly damaging Het
Muc5b T C 7: 141,400,164 (GRCm39) C473R unknown Het
N4bp2l1 T A 5: 150,500,210 (GRCm39) R66* probably null Het
Nes A G 3: 87,884,479 (GRCm39) T913A possibly damaging Het
Oas1a T C 5: 121,037,322 (GRCm39) E235G probably damaging Het
Or5p56 T C 7: 107,590,396 (GRCm39) S275P probably damaging Het
Or8b1c T C 9: 38,384,504 (GRCm39) S154P possibly damaging Het
Or8i2 T A 2: 86,851,964 (GRCm39) H308L probably benign Het
Parn C T 16: 13,458,158 (GRCm39) V286I probably benign Het
Paxip1 G A 5: 27,970,940 (GRCm39) Q470* probably null Het
Phc2 C G 4: 128,617,503 (GRCm39) H510D possibly damaging Het
Pla2g4f T A 2: 120,135,522 (GRCm39) D384V probably damaging Het
Plpbp A T 8: 27,535,159 (GRCm39) N68I probably damaging Het
Podxl2 G A 6: 88,826,937 (GRCm39) A123V possibly damaging Het
Pole A T 5: 110,473,416 (GRCm39) T1737S possibly damaging Het
Ppp3cc T C 14: 70,462,476 (GRCm39) E396G probably damaging Het
Pramel7 T A 2: 87,321,352 (GRCm39) I228F probably benign Het
Prl7d1 A T 13: 27,894,123 (GRCm39) C149S probably benign Het
Qtrt1 G T 9: 21,329,584 (GRCm39) M217I probably benign Het
Sec24a T A 11: 51,620,281 (GRCm39) D456V probably damaging Het
Shox2 T G 3: 66,888,877 (GRCm39) probably null Het
Skint2 T A 4: 112,481,283 (GRCm39) S49T probably damaging Het
Smarca5 A G 8: 81,447,315 (GRCm39) probably null Het
Tmem114 T C 16: 8,229,966 (GRCm39) probably null Het
Ttc7b T A 12: 100,321,305 (GRCm39) M24L probably benign Het
Ttll3 A G 6: 113,385,864 (GRCm39) probably null Het
Usp7 C T 16: 8,522,846 (GRCm39) D102N probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCACACAGATCAAGCCAGATG -3'
(R):5'- CGCTGGAATGAGAGCTTGCTGATG -3'

Sequencing Primer
(F):5'- ATGGTGAGGCCCAGAGC -3'
(R):5'- CATCAGTGGCTCCTAGTGAAC -3'
Posted On 2013-07-11