Incidental Mutation 'R7400:Pnpla1'
ID574131
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7400 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28858976 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 37 (D37V)
Ref Sequence ENSEMBL: ENSMUSP00000050123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect probably damaging
Transcript: ENSMUST00000056866
AA Change: D37V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: D37V

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114737
AA Change: D37V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286
AA Change: D37V

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,250,662 E690V probably benign Het
4932414N04Rik T C 2: 68,666,203 S118P unknown Het
Ahnak T A 19: 9,014,613 D4420E probably damaging Het
Atp5g2 C T 15: 102,665,112 A90T possibly damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cd48 G A 1: 171,695,925 R112H probably benign Het
Cdh8 A T 8: 99,279,560 Y132N probably damaging Het
Cfap70 A C 14: 20,408,267 S793A probably benign Het
Cyp1a2 T C 9: 57,681,940 N197S probably benign Het
Diaph1 T C 18: 37,854,502 D1067G probably damaging Het
Disp2 T C 2: 118,791,886 L1033P probably damaging Het
Dock6 G T 9: 21,801,807 A1981D possibly damaging Het
Eci3 T C 13: 34,959,977 D55G probably benign Het
Eea1 T A 10: 95,995,570 D174E probably benign Het
Ehd2 T C 7: 15,950,656 E406G possibly damaging Het
Erich3 A G 3: 154,762,577 K889E Het
Fat4 C A 3: 38,887,924 T322K probably damaging Het
Fitm1 A T 14: 55,576,769 I241F possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Gm4070 T A 7: 105,902,040 I602F probably benign Het
Gpsm2 T A 3: 108,679,688 D644V probably damaging Het
Gucy2d C A 7: 98,443,640 L75M possibly damaging Het
Hmcn1 T C 1: 150,674,430 I2668V probably damaging Het
Hoxa7 A G 6: 52,217,053 I118T possibly damaging Het
Hsp90ab1 A G 17: 45,569,284 V473A probably benign Het
Ighv1-72 A G 12: 115,758,217 S40P probably damaging Het
Kif28 A C 1: 179,700,274 W771G probably damaging Het
Klf13 G C 7: 63,938,248 A100G probably benign Het
Klhl5 A G 5: 65,148,590 E300G possibly damaging Het
Krt40 A G 11: 99,543,143 S6P probably benign Het
Map3k13 C T 16: 21,922,322 R800W probably damaging Het
Mef2d T C 3: 88,167,731 L408P possibly damaging Het
Mmp10 T A 9: 7,503,300 M87K probably damaging Het
Mrgprd T A 7: 145,321,906 H171Q probably benign Het
Muc1 C T 3: 89,230,646 T265I possibly damaging Het
Myo15b A G 11: 115,860,113 N570D Het
Nfs1 T A 2: 156,126,323 I408F probably damaging Het
Npdc1 G T 2: 25,406,245 C48F probably damaging Het
Olfr137 A T 17: 38,305,331 N43K possibly damaging Het
Olfr459 A T 6: 41,771,744 L185H probably damaging Het
Olfr592 T C 7: 103,187,380 S260P probably damaging Het
Olfr676 T C 7: 105,035,210 I4T probably benign Het
Osbpl2 T C 2: 180,153,321 M332T probably benign Het
Ostm1 T A 10: 42,698,217 V302D probably damaging Het
Otof T C 5: 30,385,188 D672G probably benign Het
Plekha6 A T 1: 133,274,024 K392* probably null Het
Rasgrp1 A G 2: 117,298,545 S198P probably damaging Het
Reln A T 5: 21,971,934 N1911K probably damaging Het
Ripply3 C A 16: 94,335,900 A140E probably benign Het
Siglec1 A G 2: 131,086,095 C8R possibly damaging Het
Slamf6 T C 1: 171,919,793 S41P unknown Het
Slc15a5 A G 6: 138,073,057 M120T probably benign Het
Slc25a20 T G 9: 108,681,973 D179E possibly damaging Het
Sltm T A 9: 70,586,070 V783E probably damaging Het
Smc1b C A 15: 85,069,720 R1116L probably damaging Het
Smim23 A G 11: 32,824,471 V16A probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spen T C 4: 141,473,741 D2525G probably damaging Het
St14 A C 9: 31,108,275 N83K probably benign Het
Stab1 T C 14: 31,157,384 N713S probably null Het
Syne1 A T 10: 5,218,580 L5267H probably benign Het
Tenm4 T C 7: 96,694,803 L271P probably damaging Het
Tfap2d C T 1: 19,142,926 H325Y possibly damaging Het
Trav23 A G 14: 53,977,563 R78G probably benign Het
Unc79 A G 12: 103,104,630 D1228G probably damaging Het
Vmn1r66 T A 7: 10,274,947 H53L probably damaging Het
Vps13b A T 15: 35,378,900 L53F probably damaging Het
Zfp532 C T 18: 65,638,913 T834M possibly damaging Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3620:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5042:Pnpla1 UTSW 17 28881047 missense probably benign
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R5886:Pnpla1 UTSW 17 28876863 missense possibly damaging 0.63
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7444:Pnpla1 UTSW 17 28878481 missense possibly damaging 0.95
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCAGCAGAGCTAAACAGGC -3'
(R):5'- CAAGCTTGTCCAGGGTCTGTTC -3'

Sequencing Primer
(F):5'- GGTAGAGTTGCCACATTCCCTG -3'
(R):5'- CCAGGGTCTGTTCTGAGAAGC -3'
Posted On2019-09-13