Incidental Mutation 'R0625:Plpbp'
ID57423
Institutional Source Beutler Lab
Gene Symbol Plpbp
Ensembl Gene ENSMUSG00000031485
Gene Namepyridoxal phosphate binding protein
SynonymsProsc, 2200002F22Rik
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R0625 (G1)
Quality Score100
Status Not validated
Chromosome8
Chromosomal Location27042555-27056132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27045131 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 68 (N68I)
Ref Sequence ENSEMBL: ENSMUSP00000147943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000033875] [ENSMUST00000098851] [ENSMUST00000209525] [ENSMUST00000209856]
Predicted Effect probably benign
Transcript: ENSMUST00000033873
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033875
AA Change: N68I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033875
Gene: ENSMUSG00000031485
AA Change: N68I

DomainStartEndE-ValueType
Pfam:Ala_racemase_N 16 251 5.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098851
AA Change: N68I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096450
Gene: ENSMUSG00000031485
AA Change: N68I

DomainStartEndE-ValueType
Pfam:Ala_racemase_N 15 138 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178990
Predicted Effect probably damaging
Transcript: ENSMUST00000209525
AA Change: N68I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209555
Predicted Effect probably damaging
Transcript: ENSMUST00000209856
AA Change: N68I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000210141
AA Change: N34I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210225
Predicted Effect unknown
Transcript: ENSMUST00000210765
AA Change: N8I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211281
Predicted Effect unknown
Transcript: ENSMUST00000211393
AA Change: N65I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211490
Predicted Effect unknown
Transcript: ENSMUST00000211518
AA Change: N59I
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyridoxal 5'-phosphate binding protein involved in the homeostatic regulation of intracellular pyridoxal 5'-phosphate. This gene has a tumor suppressive effect on hepatocellular carcinoma and other solid tumors of epithelial origin. Naturally occurring mutations in this gene are associated with a pyridoxine-dependent epilepsy. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Plpbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Plpbp APN 8 27045924 missense probably benign 0.02
R1770:Plpbp UTSW 8 27053298 missense probably damaging 0.98
R1835:Plpbp UTSW 8 27049231 missense probably damaging 0.99
R6659:Plpbp UTSW 8 27052279 missense possibly damaging 0.47
R6857:Plpbp UTSW 8 27045426 missense possibly damaging 0.81
R7190:Plpbp UTSW 8 27051297 missense probably benign
X0013:Plpbp UTSW 8 27053289 nonsense probably null
X0066:Plpbp UTSW 8 27053289 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACCTGTCTCATGTGCCCAAAC -3'
(R):5'- AGAACGAGTCAGAAGCCTGGTAGTC -3'

Sequencing Primer
(F):5'- gtttgtttgtttgttttgtttgtttg -3'
(R):5'- TCTCCCAACAGttcttttttttttc -3'
Posted On2013-07-11