Incidental Mutation 'R0625:Smarca5'
ID57425
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
SynonymsD030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0625 (G1)
Quality Score97
Status Not validated
Chromosome8
Chromosomal Location80698507-80739497 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 80720686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
Predicted Effect probably null
Transcript: ENSMUST00000043359
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148455
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense not run
Predicted Primers PCR Primer
(F):5'- AAGCCAGTCTGGTGTGCTGACTTG -3'
(R):5'- ACACTTGATCTTAGCCAAAAGGCCG -3'

Sequencing Primer
(F):5'- GTGTGCTGACTTGCCTCC -3'
(R):5'- agccaaaaggccgagaag -3'
Posted On2013-07-11