Incidental Mutation 'R0625:Olfr905'
ID57427
Institutional Source Beutler Lab
Gene Symbol Olfr905
Ensembl Gene ENSMUSG00000096794
Gene Nameolfactory receptor 905
SynonymsMOR167-1, GA_x6K02T2PVTD-32165709-32166641
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0625 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38471107-38477013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38473208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000150357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051111] [ENSMUST00000214377] [ENSMUST00000216724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051111
AA Change: S154P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057998
Gene: ENSMUSG00000096794
AA Change: S154P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-50 PFAM
Pfam:7tm_1 41 298 4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214377
AA Change: S154P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000216724
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Olfr905
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr905 APN 9 38473042 missense possibly damaging 0.52
IGL03168:Olfr905 APN 9 38473019 missense probably benign
R0003:Olfr905 UTSW 9 38473316 missense probably benign 0.24
R0062:Olfr905 UTSW 9 38473258 missense probably benign 0.03
R0744:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R0836:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R2085:Olfr905 UTSW 9 38472927 missense probably damaging 1.00
R2898:Olfr905 UTSW 9 38472975 missense probably damaging 0.99
R4462:Olfr905 UTSW 9 38473064 missense probably benign 0.32
R4655:Olfr905 UTSW 9 38472824 missense probably damaging 0.99
R5209:Olfr905 UTSW 9 38473521 missense possibly damaging 0.52
R5759:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R6453:Olfr905 UTSW 9 38473575 missense probably benign 0.18
R6501:Olfr905 UTSW 9 38473289 missense possibly damaging 0.88
R6934:Olfr905 UTSW 9 38473176 missense probably benign
R6999:Olfr905 UTSW 9 38473239 missense probably damaging 1.00
R7295:Olfr905 UTSW 9 38473443 missense probably benign 0.07
X0053:Olfr905 UTSW 9 38473176 missense probably benign
X0065:Olfr905 UTSW 9 38473006 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACCAAGGAGTCCGATCTCCAGTG -3'
(R):5'- GGCACAATGATGTTGATGCCCAC -3'

Sequencing Primer
(F):5'- ATTTCCTACAGAGGATGCATGGC -3'
(R):5'- CAACAACAAATACCTCCAGTTCATTG -3'
Posted On2013-07-11