Incidental Mutation 'R7403:Slc2a1'
ID574333
Institutional Source Beutler Lab
Gene Symbol Slc2a1
Ensembl Gene ENSMUSG00000028645
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 1
SynonymsGlut1, Glut-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location119108711-119137983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119132555 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 130 (G130S)
Ref Sequence ENSEMBL: ENSMUSP00000030398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030398] [ENSMUST00000134105] [ENSMUST00000144329] [ENSMUST00000174372] [ENSMUST00000208090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030398
AA Change: G130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030398
Gene: ENSMUSG00000028645
AA Change: G130S

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 467 1e-164 PFAM
Pfam:MFS_1 24 418 1.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134105
AA Change: G126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118641
Gene: ENSMUSG00000028645
AA Change: G126S

DomainStartEndE-ValueType
Pfam:Sugar_tr 12 128 7.7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144329
AA Change: G118S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134126
Gene: ENSMUSG00000028645
AA Change: G118S

DomainStartEndE-ValueType
Pfam:Sugar_tr 4 123 1.5e-35 PFAM
Pfam:MFS_1 5 123 3.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174372
AA Change: G130S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134714
Gene: ENSMUSG00000028645
AA Change: G130S

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 173 9.3e-53 PFAM
Pfam:MFS_1 18 172 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208090
AA Change: G98S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null embryos are small, lack visibly detectable eyes, show a diminutive rostral embryonic pole and an overall developmental delay, and die at E10-E14. Heterozygotes show spontaneous seizures, impaired motor performance, hypoglycorrhachia, microencephaly, and reduced brain glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Slc2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Slc2a1 APN 4 119132238 missense possibly damaging 0.94
IGL01876:Slc2a1 APN 4 119133378 missense probably benign 0.11
IGL02355:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
IGL02362:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
R1076:Slc2a1 UTSW 4 119134448 missense probably damaging 0.98
R1561:Slc2a1 UTSW 4 119136409 missense possibly damaging 0.86
R1616:Slc2a1 UTSW 4 119136306 missense probably damaging 1.00
R3015:Slc2a1 UTSW 4 119132143 missense probably damaging 1.00
R4166:Slc2a1 UTSW 4 119133116 missense probably damaging 0.97
R4795:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R4796:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R6025:Slc2a1 UTSW 4 119136342 missense possibly damaging 0.68
R7429:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7430:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7524:Slc2a1 UTSW 4 119132612 missense not run
Predicted Primers PCR Primer
(F):5'- TCATCCTGTCTGGGGAGTTC -3'
(R):5'- TCTGGGATCTGTCTACCATGAGG -3'

Sequencing Primer
(F):5'- GTGGCAGAAACATCCCTGACTATG -3'
(R):5'- CCATGAGGTTGTCCTAGGC -3'
Posted On2019-09-13