Incidental Mutation 'R7225:Clcn1'
ID 574656
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 045297-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7225 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 42270396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 232 (D232N)
Ref Sequence ENSEMBL: ENSMUSP00000126045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably benign
Transcript: ENSMUST00000031894
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163936
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168660
AA Change: D232N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: D232N

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: D235N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,637,299 (GRCm39) probably benign Het
5730480H06Rik T A 5: 48,537,575 (GRCm39) probably null Het
Actn4 A T 7: 28,598,124 (GRCm39) V492D probably damaging Het
Alpk2 T C 18: 65,438,270 (GRCm39) E1041G probably benign Het
Asap1 G A 15: 64,002,099 (GRCm39) T404M probably damaging Het
Cd22 C T 7: 30,577,059 (GRCm39) A83T not run Het
Cdan1 T C 2: 120,555,393 (GRCm39) T783A probably benign Het
Cdh9 C T 15: 16,856,159 (GRCm39) S733F probably damaging Het
Cfap54 A G 10: 92,740,236 (GRCm39) F2282S unknown Het
Chst9 T C 18: 15,585,718 (GRCm39) K282E probably damaging Het
Clpb T A 7: 101,360,672 (GRCm39) L234Q probably damaging Het
Cluh T G 11: 74,557,232 (GRCm39) probably null Het
Cnp C T 11: 100,471,413 (GRCm39) Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,577,937 (GRCm39) probably null Het
Dtx3 C T 10: 127,027,358 (GRCm39) C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 (GRCm39) I1156T probably benign Het
Epg5 T A 18: 78,055,917 (GRCm39) V1697E probably benign Het
Exoc3l4 A G 12: 111,390,058 (GRCm39) D211G probably benign Het
Fank1 A G 7: 133,454,988 (GRCm39) K36R probably benign Het
Fat4 T C 3: 39,034,325 (GRCm39) I2659T possibly damaging Het
Fer1l5 T C 1: 36,460,033 (GRCm39) W1893R possibly damaging Het
Gorasp2 T A 2: 70,514,391 (GRCm39) L256Q probably damaging Het
Gpc5 T G 14: 115,789,710 (GRCm39) V528G probably damaging Het
Gria2 T A 3: 80,709,938 (GRCm39) probably benign Het
Htatip2 A G 7: 49,420,604 (GRCm39) E150G possibly damaging Het
Jak3 C A 8: 72,138,155 (GRCm39) Q869K probably benign Het
Jmjd1c T C 10: 67,061,844 (GRCm39) V1218A probably benign Het
Kcnf1 A G 12: 17,225,694 (GRCm39) C176R possibly damaging Het
Kcnq4 A G 4: 120,604,111 (GRCm39) V88A probably benign Het
Lmod3 T A 6: 97,224,345 (GRCm39) D492V probably benign Het
Lurap1l A C 4: 80,829,718 (GRCm39) S43R probably benign Het
Mamdc4 T C 2: 25,455,558 (GRCm39) H890R possibly damaging Het
Mertk T G 2: 128,643,482 (GRCm39) N960K possibly damaging Het
Nudt9 C A 5: 104,212,966 (GRCm39) D346E probably benign Het
Obi1 T C 14: 104,717,294 (GRCm39) T360A probably benign Het
Opa1 A G 16: 29,432,857 (GRCm39) probably null Het
Or5an1 A T 19: 12,260,831 (GRCm39) T140S probably benign Het
Oxr1 C T 15: 41,677,004 (GRCm39) P187L not run Het
Paxbp1 T C 16: 90,823,956 (GRCm39) E564G probably damaging Het
Pcdhb13 C T 18: 37,577,490 (GRCm39) R623C possibly damaging Het
Pkhd1l1 G T 15: 44,410,337 (GRCm39) V2615F probably damaging Het
Plin3 T C 17: 56,593,541 (GRCm39) T58A possibly damaging Het
Por A G 5: 135,761,441 (GRCm39) D309G probably benign Het
Ppp2r5e T C 12: 75,515,353 (GRCm39) K261R probably damaging Het
Ptpn18 C T 1: 34,511,927 (GRCm39) T366I possibly damaging Het
Ptprz1 G A 6: 23,000,928 (GRCm39) G1006E possibly damaging Het
Rpl12 C T 2: 32,851,909 (GRCm39) probably benign Het
Rpsa T G 9: 119,960,222 (GRCm39) F262V probably benign Het
Sh3pxd2a G T 19: 47,255,828 (GRCm39) N991K probably damaging Het
Shank2 T A 7: 143,838,762 (GRCm39) N19K probably benign Het
Sik1 T C 17: 32,073,274 (GRCm39) T61A probably benign Het
Sipa1l3 A C 7: 29,098,853 (GRCm39) V472G probably damaging Het
Sirt6 A G 10: 81,458,315 (GRCm39) S313P probably benign Het
Slc12a7 A G 13: 73,912,081 (GRCm39) probably benign Het
Sox13 A T 1: 133,314,862 (GRCm39) V266E probably benign Het
Spag9 T C 11: 93,988,184 (GRCm39) C833R probably damaging Het
Tcof1 T C 18: 60,961,520 (GRCm39) T812A unknown Het
Tnfsf4 A G 1: 161,244,821 (GRCm39) D170G possibly damaging Het
Tshz3 A G 7: 36,469,082 (GRCm39) N357S probably damaging Het
Txk C T 5: 72,858,057 (GRCm39) D418N probably damaging Het
Ube2j2 A G 4: 156,033,773 (GRCm39) probably null Het
Vmn2r84 G A 10: 130,222,552 (GRCm39) P556L probably damaging Het
Zfp1007 T C 5: 109,825,015 (GRCm39) H145R possibly damaging Het
Zfp442 T C 2: 150,250,925 (GRCm39) N326D probably benign Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42,290,046 (GRCm39) missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42,269,929 (GRCm39) missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5528:Clcn1 UTSW 6 42,277,275 (GRCm39) missense probably benign 0.01
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7020:Clcn1 UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCCTACCCACATGAACTG -3'
(R):5'- AAACATATGGGTCCCTGGAGC -3'

Sequencing Primer
(F):5'- ATGAACTGTGTCGATTCCTTTCCATG -3'
(R):5'- AGGTGTGGCAATCCAGTCACTC -3'
Posted On 2019-09-27