Incidental Mutation 'R7407:Adamts17'
ID 574788
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms AU023434
MMRRC Submission 045488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7407 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 66489483-66802919 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 66697304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 28 (Y28*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
AlphaFold E9Q4D1
Predicted Effect probably null
Transcript: ENSMUST00000098382
AA Change: Y659*
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: Y659*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107478
AA Change: Y659*
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: Y659*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154103
AA Change: Y28*
SMART Domains Protein: ENSMUSP00000121836
Gene: ENSMUSG00000058145
AA Change: Y28*

DomainStartEndE-ValueType
Pfam:ADAM_spacer1 68 178 4e-31 PFAM
Blast:TSP1 199 234 6e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,249,626 (GRCm39) N220S probably damaging Het
Abcb8 T C 5: 24,605,674 (GRCm39) V186A probably benign Het
Actbl2 A T 13: 111,392,752 (GRCm39) E362D probably damaging Het
Agtr1b T C 3: 20,369,895 (GRCm39) D237G possibly damaging Het
Amer2 A G 14: 60,616,291 (GRCm39) D162G probably damaging Het
Ankub1 T C 3: 57,572,624 (GRCm39) E366G probably benign Het
Ap5z1 A G 5: 142,452,330 (GRCm39) I88V probably benign Het
Ccdc186 T C 19: 56,801,817 (GRCm39) N100S probably benign Het
Cldn19 A G 4: 119,112,882 (GRCm39) D38G probably damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Deaf1 G A 7: 140,877,492 (GRCm39) A545V possibly damaging Het
Dicer1 G T 12: 104,688,610 (GRCm39) Y322* probably null Het
Dnajb7 G T 15: 81,291,827 (GRCm39) T170K possibly damaging Het
Flrt2 A T 12: 95,746,074 (GRCm39) E137D probably damaging Het
Galnt12 T C 4: 47,120,362 (GRCm39) F482L probably damaging Het
Gm32742 A G 9: 51,067,974 (GRCm39) V336A probably damaging Het
Gpatch8 G A 11: 102,370,656 (GRCm39) R961W unknown Het
Hcn4 A G 9: 58,766,653 (GRCm39) E738G unknown Het
Kdelr3 A G 15: 79,409,039 (GRCm39) Y76C probably damaging Het
Krt77 T C 15: 101,768,530 (GRCm39) S494G unknown Het
Letmd1 G T 15: 100,367,119 (GRCm39) A39S probably benign Het
Lrrc7 G A 3: 157,840,878 (GRCm39) R1387W probably damaging Het
Meltf T C 16: 31,713,553 (GRCm39) Y599H probably damaging Het
Mybpc1 T A 10: 88,385,209 (GRCm39) I477L probably damaging Het
Nf1 A G 11: 79,338,969 (GRCm39) D1174G probably damaging Het
Or2t6 T A 14: 14,175,402 (GRCm38) I227L probably benign Het
Or8b44 T A 9: 38,410,800 (GRCm39) Y278* probably null Het
Palld G T 8: 61,968,975 (GRCm39) S1283* probably null Het
Pcmtd2 T C 2: 181,488,398 (GRCm39) V183A possibly damaging Het
Pcsk5 T A 19: 17,652,880 (GRCm39) I269F probably damaging Het
Pkd1 T C 17: 24,813,568 (GRCm39) L4036P probably damaging Het
Pkhd1l1 A G 15: 44,458,407 (GRCm39) N4151S possibly damaging Het
Rcor3 C T 1: 191,785,972 (GRCm39) S422N probably benign Het
Rhag A G 17: 41,142,225 (GRCm39) I223V possibly damaging Het
Ssbp4 A G 8: 71,051,672 (GRCm39) Y231H probably damaging Het
Syce1l C T 8: 114,381,770 (GRCm39) Q237* probably null Het
Tenm4 T C 7: 96,423,194 (GRCm39) V663A possibly damaging Het
Timd6 A G 11: 46,468,217 (GRCm39) Y97C probably damaging Het
Trim6 T C 7: 103,875,108 (GRCm39) I115T probably damaging Het
Vinac1 A G 2: 128,880,729 (GRCm39) I399T Het
Vmn1r25 T A 6: 57,956,044 (GRCm39) T82S possibly damaging Het
Vmn2r28 A G 7: 5,484,308 (GRCm39) S631P probably damaging Het
Xpo1 T A 11: 23,235,823 (GRCm39) V637E probably damaging Het
Xpo6 A T 7: 125,770,224 (GRCm39) M62K probably damaging Het
Ypel5 A G 17: 73,153,374 (GRCm39) N26S possibly damaging Het
Zbtb24 C A 10: 41,340,775 (GRCm39) Q624K possibly damaging Het
Zfp629 T C 7: 127,209,415 (GRCm39) D798G probably benign Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66,618,650 (GRCm39) missense probably damaging 1.00
IGL00950:Adamts17 APN 7 66,770,660 (GRCm39) missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66,558,349 (GRCm39) missense probably damaging 1.00
IGL01591:Adamts17 APN 7 66,654,144 (GRCm39) missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66,538,159 (GRCm39) missense probably benign 0.29
IGL01640:Adamts17 APN 7 66,679,428 (GRCm39) missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66,490,037 (GRCm39) missense probably benign 0.06
IGL01747:Adamts17 APN 7 66,701,759 (GRCm39) missense probably damaging 1.00
IGL02081:Adamts17 APN 7 66,711,858 (GRCm39) missense probably damaging 1.00
IGL02152:Adamts17 APN 7 66,774,748 (GRCm39) missense probably benign 0.01
IGL02264:Adamts17 APN 7 66,697,207 (GRCm39) splice site probably null
IGL02457:Adamts17 APN 7 66,677,562 (GRCm39) missense probably damaging 0.99
IGL02519:Adamts17 APN 7 66,774,721 (GRCm39) missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66,559,124 (GRCm39) missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66,499,626 (GRCm39) splice site probably benign
IGL02711:Adamts17 APN 7 66,701,788 (GRCm39) splice site probably benign
IGL03006:Adamts17 APN 7 66,728,095 (GRCm39) missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 66,711,856 (GRCm39) missense probably damaging 1.00
IGL03343:Adamts17 APN 7 66,725,064 (GRCm39) missense probably damaging 1.00
BB007:Adamts17 UTSW 7 66,499,547 (GRCm39) missense probably damaging 0.96
BB017:Adamts17 UTSW 7 66,499,547 (GRCm39) missense probably damaging 0.96
E2594:Adamts17 UTSW 7 66,654,098 (GRCm39) missense probably damaging 1.00
R0380:Adamts17 UTSW 7 66,799,792 (GRCm39) missense probably benign 0.00
R0416:Adamts17 UTSW 7 66,565,646 (GRCm39) splice site probably null
R0635:Adamts17 UTSW 7 66,558,353 (GRCm39) missense probably damaging 1.00
R1083:Adamts17 UTSW 7 66,797,322 (GRCm39) missense probably damaging 1.00
R1476:Adamts17 UTSW 7 66,725,091 (GRCm39) missense probably damaging 1.00
R1728:Adamts17 UTSW 7 66,799,704 (GRCm39) nonsense probably null
R1729:Adamts17 UTSW 7 66,799,704 (GRCm39) nonsense probably null
R1763:Adamts17 UTSW 7 66,797,463 (GRCm39) missense probably damaging 1.00
R1784:Adamts17 UTSW 7 66,799,704 (GRCm39) nonsense probably null
R1905:Adamts17 UTSW 7 66,697,220 (GRCm39) nonsense probably null
R1938:Adamts17 UTSW 7 66,774,820 (GRCm39) missense probably damaging 1.00
R3106:Adamts17 UTSW 7 66,774,820 (GRCm39) missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66,489,662 (GRCm39) splice site probably null
R3849:Adamts17 UTSW 7 66,490,215 (GRCm39) missense possibly damaging 0.92
R3850:Adamts17 UTSW 7 66,490,215 (GRCm39) missense possibly damaging 0.92
R3945:Adamts17 UTSW 7 66,770,687 (GRCm39) missense probably benign
R4519:Adamts17 UTSW 7 66,490,314 (GRCm39) missense probably damaging 0.99
R4554:Adamts17 UTSW 7 66,677,641 (GRCm39) missense probably damaging 1.00
R4555:Adamts17 UTSW 7 66,677,641 (GRCm39) missense probably damaging 1.00
R4556:Adamts17 UTSW 7 66,677,641 (GRCm39) missense probably damaging 1.00
R4557:Adamts17 UTSW 7 66,677,641 (GRCm39) missense probably damaging 1.00
R4700:Adamts17 UTSW 7 66,691,636 (GRCm39) missense probably damaging 1.00
R4752:Adamts17 UTSW 7 66,654,218 (GRCm39) missense probably damaging 0.96
R5019:Adamts17 UTSW 7 66,711,818 (GRCm39) nonsense probably null
R5438:Adamts17 UTSW 7 66,538,165 (GRCm39) missense probably benign 0.30
R5444:Adamts17 UTSW 7 66,691,647 (GRCm39) missense probably benign 0.02
R5673:Adamts17 UTSW 7 66,691,555 (GRCm39) missense probably damaging 1.00
R6326:Adamts17 UTSW 7 66,770,636 (GRCm39) missense probably benign 0.05
R6964:Adamts17 UTSW 7 66,654,101 (GRCm39) missense probably benign 0.00
R6964:Adamts17 UTSW 7 66,559,148 (GRCm39) missense possibly damaging 0.93
R7129:Adamts17 UTSW 7 66,770,758 (GRCm39) missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66,490,304 (GRCm39) nonsense probably null
R7355:Adamts17 UTSW 7 66,725,052 (GRCm39) missense
R7386:Adamts17 UTSW 7 66,618,597 (GRCm39) missense probably benign 0.25
R7432:Adamts17 UTSW 7 66,701,665 (GRCm39) missense
R7782:Adamts17 UTSW 7 66,774,802 (GRCm39) missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66,559,224 (GRCm39) missense probably damaging 0.99
R7930:Adamts17 UTSW 7 66,499,547 (GRCm39) missense probably damaging 0.96
R7993:Adamts17 UTSW 7 66,499,612 (GRCm39) missense possibly damaging 0.90
R8178:Adamts17 UTSW 7 66,499,464 (GRCm39) missense possibly damaging 0.46
R8962:Adamts17 UTSW 7 66,725,057 (GRCm39) missense probably damaging 1.00
R9095:Adamts17 UTSW 7 66,654,117 (GRCm39) missense probably damaging 1.00
R9111:Adamts17 UTSW 7 66,489,648 (GRCm39) missense probably damaging 0.96
R9303:Adamts17 UTSW 7 66,489,645 (GRCm39) missense probably damaging 0.99
R9305:Adamts17 UTSW 7 66,489,645 (GRCm39) missense probably damaging 0.99
R9505:Adamts17 UTSW 7 66,774,683 (GRCm39) missense probably benign 0.00
R9668:Adamts17 UTSW 7 66,797,438 (GRCm39) missense possibly damaging 0.61
X0022:Adamts17 UTSW 7 66,691,649 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGATCTGCACTAATGGCTCTGC -3'
(R):5'- TACTCAGTCACTGCCAAGGG -3'

Sequencing Primer
(F):5'- GGCTCACTGCTCACTTGTG -3'
(R):5'- CATGTGCTGGTGCCACTG -3'
Posted On 2019-10-07