Incidental Mutation 'R0626:Hectd4'
ID57479
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121277824 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 563 (S563T)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: S563T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: S563T

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGACAGTCAGACCATCCCATAG -3'
(R):5'- aaaCAATGTGATTTCTtggcttcctgc -3'

Sequencing Primer
(F):5'- gggaatcagagccgtgtag -3'
(R):5'- gcttcctgctatgctgcc -3'
Posted On2013-07-11