Incidental Mutation 'R0628:Bank1'
ID57687
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission 038817-MU
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0628 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136066390 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 493 (D493V)
Ref Sequence ENSEMBL: ENSMUSP00000142996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: D694V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: D694V

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196159
AA Change: D561V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: D561V

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198206
AA Change: D493V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922
AA Change: D493V

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198354
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,678,576 probably null Het
Alpk2 A C 18: 65,307,296 V809G possibly damaging Het
Camk2d T C 3: 126,810,624 probably benign Het
Ccdc17 T A 4: 116,598,548 L292H probably damaging Het
Ccdc7b A G 8: 129,111,017 probably benign Het
Cd34 C A 1: 194,959,217 T317K probably damaging Het
Col6a5 C G 9: 105,912,450 probably null Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Copa T C 1: 172,091,025 probably benign Het
Coq7 T C 7: 118,529,644 D56G probably damaging Het
Dlg4 C T 11: 70,031,784 T201I probably damaging Het
Dnah7a T A 1: 53,497,105 D2593V probably benign Het
Ect2l T A 10: 18,143,040 E536V probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eml2 T C 7: 19,201,554 probably benign Het
Fam135b C T 15: 71,448,656 probably benign Het
Fam160b2 T C 14: 70,587,721 T392A possibly damaging Het
Gart C T 16: 91,633,902 R424H probably benign Het
Gm9745 T A 13: 8,940,922 probably benign Het
Gramd1a A G 7: 31,142,624 L80P probably damaging Het
Herc1 A G 9: 66,450,881 K2415E probably benign Het
Ica1 C T 6: 8,644,256 probably benign Het
Iyd A T 10: 3,547,127 M161L probably damaging Het
Kdm5a T C 6: 120,415,239 L974S probably damaging Het
Kif1a T C 1: 93,019,883 D1619G probably damaging Het
Lypd8 C T 11: 58,384,673 T78M probably damaging Het
March10 T A 11: 105,390,160 H433L probably benign Het
Mbp A G 18: 82,554,617 Y13C probably damaging Het
Mertk A T 2: 128,738,313 N229I probably damaging Het
Msrb2 T A 2: 19,393,280 D116E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Otoa G A 7: 121,145,650 probably benign Het
Pclo A G 5: 14,669,538 T1230A unknown Het
Polrmt T C 10: 79,739,145 T851A possibly damaging Het
Prpf6 C T 2: 181,636,048 P401L probably damaging Het
Rasgrp4 A G 7: 29,140,210 probably benign Het
Rc3h2 A T 2: 37,382,052 probably benign Het
Reps1 A G 10: 18,121,093 T588A probably damaging Het
Rtel1 A C 2: 181,351,881 S782R probably benign Het
Sacm1l A G 9: 123,548,995 probably benign Het
Skint5 A T 4: 113,731,069 L728* probably null Het
Slc9b2 T A 3: 135,323,775 probably benign Het
Snapc3 A T 4: 83,450,160 H298L probably benign Het
Tex9 A T 9: 72,491,951 M1K probably null Het
Trappc13 C T 13: 104,154,916 probably benign Het
Ttc37 G C 13: 76,150,729 V1185L possibly damaging Het
Usp3 C T 9: 66,518,444 R467H probably benign Het
Vmn2r11 T A 5: 109,047,731 L576F possibly damaging Het
Wnk4 T C 11: 101,275,023 F792S probably benign Het
Zfp280d T C 9: 72,361,948 V764A probably benign Het
Zfp69 G A 4: 120,949,425 Q4* probably null Het
Zfp692 T G 11: 58,309,623 L206R probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zic4 T A 9: 91,384,117 Y264* probably null Het
Zic4 T A 9: 91,384,119 M272K probably benign Het
Zscan4b A T 7: 10,901,463 N284K probably damaging Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
PIT4504001:Bank1 UTSW 3 136100419 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7013:Bank1 UTSW 3 136100509 missense possibly damaging 0.74
R7436:Bank1 UTSW 3 136055800 missense possibly damaging 0.76
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCCCAAGGTTGAGTCCATACAAA -3'
(R):5'- TCAGTTAAGAGGGAGAGAATCCAATGGT -3'

Sequencing Primer
(F):5'- TAACTCATCAGTGCAGACTTCGG -3'
(R):5'- GAAATGATTTTTGTCCCAGTAGTTCG -3'
Posted On2013-07-11