Incidental Mutation 'R0629:Ptgs2'
ID57730
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Nameprostaglandin-endoperoxide synthase 2
SynonymsCox-2, PHS-2, COX2, prostaglandin G/H synthase, PGHS-2, Pghs2, Tis10, cyclooxygenase 2, cyclooxygenase-2
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150100031-150108227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150101037 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 7 (Q7R)
Ref Sequence ENSEMBL: ENSMUSP00000139904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
Predicted Effect probably benign
Transcript: ENSMUST00000035065
AA Change: Q39R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: Q39R

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181915
Predicted Effect probably benign
Transcript: ENSMUST00000190784
AA Change: Q7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487
AA Change: Q7R

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 150104424 missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 150103727 missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 150101989 critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 150103679 unclassified probably null
IGL02309:Ptgs2 APN 1 150105556 missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 150105709 unclassified probably null
IGL02574:Ptgs2 APN 1 150102775 nonsense probably null
IGL03156:Ptgs2 APN 1 150105477 missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 150104277 unclassified probably benign
R0631:Ptgs2 UTSW 1 150104537 missense probably benign 0.30
R0811:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0812:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0980:Ptgs2 UTSW 1 150104310 missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 150105477 missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 150103868 critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 150101270 missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 150104399 missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 150100228 missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 150105714 missense probably benign
R2361:Ptgs2 UTSW 1 150103975 missense probably benign 0.00
R2927:Ptgs2 UTSW 1 150101260 missense possibly damaging 0.95
R3966:Ptgs2 UTSW 1 150105475 missense probably damaging 0.99
R4291:Ptgs2 UTSW 1 150100251 missense probably benign
R4580:Ptgs2 UTSW 1 150104094 missense possibly damaging 0.78
R4668:Ptgs2 UTSW 1 150101084 missense probably benign 0.32
R4751:Ptgs2 UTSW 1 150104020 missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 150105387 missense probably benign 0.03
R5264:Ptgs2 UTSW 1 150102730 missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 150104108 missense probably damaging 1.00
R5587:Ptgs2 UTSW 1 150105555 missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 150105528 missense probably benign 0.18
R5850:Ptgs2 UTSW 1 150105376 missense probably benign 0.03
R6137:Ptgs2 UTSW 1 150100993 missense probably benign 0.08
R6513:Ptgs2 UTSW 1 150100128 unclassified probably benign
R6553:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 150101033 missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 150102078 missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 150105540 missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 150102761 missense probably benign 0.01
R7320:Ptgs2 UTSW 1 150102695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTGAAAAGCATAGATGTGGGCAAC -3'
(R):5'- AGGAAGAATGAGCAGGCCCCTC -3'

Sequencing Primer
(F):5'- TGTGAACTATGAAGTTAGGTCCTC -3'
(R):5'- AGGCCCCTCCCCCATAG -3'
Posted On2013-07-11