Incidental Mutation 'R0629:Isyna1'
ID57753
Institutional Source Beutler Lab
Gene Symbol Isyna1
Ensembl Gene ENSMUSG00000019139
Gene Namemyo-inositol 1-phosphate synthase A1
Synonyms
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R0629 (G1)
Quality Score151
Status Validated
Chromosome8
Chromosomal Location70594373-70597290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70594708 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 27 (Y27C)
Ref Sequence ENSEMBL: ENSMUSP00000148077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019283] [ENSMUST00000049908] [ENSMUST00000093454] [ENSMUST00000209285] [ENSMUST00000210005] [ENSMUST00000210369] [ENSMUST00000210580] [ENSMUST00000211117] [ENSMUST00000211197] [ENSMUST00000211608]
Predicted Effect probably damaging
Transcript: ENSMUST00000019283
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019283
Gene: ENSMUSG00000019139
AA Change: Y27C

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:NAD_binding_5 59 491 4.4e-141 PFAM
Pfam:Inos-1-P_synth 307 420 6.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049908
SMART Domains Protein: ENSMUSP00000059039
Gene: ENSMUSG00000070003

DomainStartEndE-ValueType
LisH 16 48 2.18e-3 SMART
Pfam:SSDP 81 123 6.7e-15 PFAM
Pfam:SSDP 121 338 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093454
SMART Domains Protein: ENSMUSP00000091163
Gene: ENSMUSG00000070002

DomainStartEndE-ValueType
Pfam:ELL 6 289 2.2e-107 PFAM
low complexity region 403 416 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
low complexity region 447 471 N/A INTRINSIC
Pfam:Occludin_ELL 494 595 6.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209285
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209751
Predicted Effect probably damaging
Transcript: ENSMUST00000210005
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210358
Predicted Effect probably benign
Transcript: ENSMUST00000210369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210382
Predicted Effect probably benign
Transcript: ENSMUST00000210580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210878
Predicted Effect probably benign
Transcript: ENSMUST00000211117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211134
Predicted Effect probably benign
Transcript: ENSMUST00000211197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211488
Predicted Effect probably benign
Transcript: ENSMUST00000211501
Predicted Effect probably benign
Transcript: ENSMUST00000211608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211773
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inositol-3-phosphate synthase enzyme. The encoded protein plays a critical role in the myo-inositol biosynthesis pathway by catalyzing the rate-limiting conversion of glucose 6-phosphate to myoinositol 1-phosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Isyna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Isyna1 APN 8 70594722 missense probably damaging 0.98
IGL01670:Isyna1 APN 8 70597056 missense probably benign 0.00
IGL02003:Isyna1 APN 8 70596757 missense possibly damaging 0.94
IGL02321:Isyna1 APN 8 70596270 missense probably damaging 1.00
IGL02649:Isyna1 APN 8 70596254 missense probably damaging 1.00
R0976:Isyna1 UTSW 8 70596286 missense probably damaging 1.00
R1186:Isyna1 UTSW 8 70595201 missense probably benign
R4869:Isyna1 UTSW 8 70596762 missense possibly damaging 0.80
R4901:Isyna1 UTSW 8 70596596 missense probably damaging 1.00
R4941:Isyna1 UTSW 8 70595496 missense probably damaging 1.00
R5141:Isyna1 UTSW 8 70594893 missense probably damaging 1.00
R5719:Isyna1 UTSW 8 70594702 missense probably damaging 1.00
R6500:Isyna1 UTSW 8 70594689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGGGCCGGTAAGTACGAAC -3'
(R):5'- TGAGACGCGCTAGTCCAACAAG -3'

Sequencing Primer
(F):5'- GGCCGGTAAGTACGAACCTATC -3'
(R):5'- GTATTCTCCTAGTAGCCACGG -3'
Posted On2013-07-11