Incidental Mutation 'R0629:Col6a6'
ID57762
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0629 (G1)
Quality Score184
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 105727165 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably benign
Transcript: ENSMUST00000098441
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195709
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAACATACCAGGTTCTACCC -3'
(R):5'- GCTTCCTAGTGGTTCCCGAAAGAC -3'

Sequencing Primer
(F):5'- AGTACGGACGATTCTTTTTCAAC -3'
(R):5'- GGTTCCCGAAAGACTCCAAAATC -3'
Posted On2013-07-11