Incidental Mutation 'R0630:Trip12'
ID57797
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84793915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 213 (R213G)
Ref Sequence ENSEMBL: ENSMUSP00000139682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]
Predicted Effect probably benign
Transcript: ENSMUST00000027421
AA Change: R171G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: R171G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185909
AA Change: R213G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: R213G

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186465
AA Change: R171G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: R171G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186648
AA Change: R171G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: R171G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186894
AA Change: R171G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: R171G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187818
SMART Domains Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189496
AA Change: R213G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: R213G

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190067
SMART Domains Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190464
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTAACTTTGGGGCTGAAGCG -3'
(R):5'- TGAAATCTGCACAATTGCCGTCAAC -3'

Sequencing Primer
(F):5'- GAAGAGCCACCAGTTTTACTCTG -3'
(R):5'- TTGCCGTCAACAAGCAAGG -3'
Posted On2013-07-11