Incidental Mutation 'R0630:Atp1a2'
ID57800
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172291275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 100 (I100N)
Ref Sequence ENSEMBL: ENSMUSP00000095072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085913
AA Change: I100N

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097464
AA Change: I100N

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: I100N

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172290721 missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172279374 missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R4953:Atp1a2 UTSW 1 172291442 intron probably benign
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172284445 intron probably benign
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6145:Atp1a2 UTSW 1 172287238 missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
R7194:Atp1a2 UTSW 1 172280627 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACCACGCTCCTAGCATGGAAGG -3'
(R):5'- GAGCCACAGTGAGTCCATATTAGCC -3'

Sequencing Primer
(F):5'- CGTCACAGGTATGTATAGAAGCCTC -3'
(R):5'- TTCTCTAAGATGCCGAGAGATG -3'
Posted On2013-07-11