Incidental Mutation 'R0630:Adgrl2'
ID57817
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0630 (G1)
Quality Score191
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148839244 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 659 (I659M)
Ref Sequence ENSEMBL: ENSMUSP00000143320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably benign
Transcript: ENSMUST00000106128
AA Change: I738M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195988
AA Change: I738M

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196526
AA Change: I721M

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: I721M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197521
Predicted Effect probably benign
Transcript: ENSMUST00000197567
AA Change: I738M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197925
Predicted Effect probably benign
Transcript: ENSMUST00000198779
AA Change: I738M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199059
AA Change: I738M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199238
AA Change: I738M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: I738M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199750
AA Change: I659M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: I659M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200154
AA Change: I721M

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: I721M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200543
AA Change: I721M

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: I721M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAACTTGTGTCTCTGACCCAGCCC -3'
(R):5'- AATGGTGAGACCACACTGCCTTG -3'

Sequencing Primer
(F):5'- CTGGGGTTTAAAACCTTCTGTGAC -3'
(R):5'- TAACACAATGGAAATGGCTTAGC -3'
Posted On2013-07-11