Incidental Mutation 'R0630:Nbeal2'
ID57849
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Nameneurobeachin-like 2
Synonyms1110014F23Rik
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110624789-110654161 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 110636034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect probably benign
Transcript: ENSMUST00000130024
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131017
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133191
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138072
Predicted Effect probably benign
Transcript: ENSMUST00000149089
SMART Domains Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 49 77 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 480 488 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153960
Predicted Effect probably benign
Transcript: ENSMUST00000167320
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184024
Predicted Effect probably benign
Transcript: ENSMUST00000196488
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
schleuter UTSW 9 110628744 missense possibly damaging 0.69
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1519:Nbeal2 UTSW 9 110636305 missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110633085 missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110631396 missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGCAGAAAGCTTCTTCACGCCC -3'
(R):5'- TTCTGGCACACCCTTGACCAAC -3'

Sequencing Primer
(F):5'- CTCTCAGATTATAGAGGGAGGCTG -3'
(R):5'- CACCGTGAATCAGGAGAGCC -3'
Posted On2013-07-11