Incidental Mutation 'R0630:Ggt1'
ID57850
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 75585502 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000072217] [ENSMUST00000134503] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably null
Transcript: ENSMUST00000006508
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000044101
Predicted Effect probably benign
Transcript: ENSMUST00000072217
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129020
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134503
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148447
Predicted Effect probably benign
Transcript: ENSMUST00000155186
SMART Domains Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 128 6.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156487
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Meta Mutation Damage Score 0.6448 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
PIT4498001:Ggt1 UTSW 10 75578855 missense possibly damaging 0.95
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0420:Ggt1 UTSW 10 75576213 splice site probably benign
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R1837:Ggt1 UTSW 10 75579294 missense probably benign 0.00
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2656:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5326:Ggt1 UTSW 10 75585706 critical splice donor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
R7224:Ggt1 UTSW 10 75574276 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCAACTTCATCAAGCCAGGTGCAG -3'
(R):5'- CGTAACTCAGAAGATGCCAGCCTC -3'

Sequencing Primer
(F):5'- ATGCAGGGCATGAGTTGG -3'
(R):5'- AGATGCCAGCCTCTAGGATG -3'
Posted On2013-07-11