Incidental Mutation 'R0630:Trim38'
ID57863
Institutional Source Beutler Lab
Gene Symbol Trim38
Ensembl Gene ENSMUSG00000064140
Gene Nametripartite motif-containing 38
SynonymsLOC214158
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23769913-23791528 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 23791132 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 351 (Y351*)
Ref Sequence ENSEMBL: ENSMUSP00000153240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074067] [ENSMUST00000223911] [ENSMUST00000226039]
Predicted Effect probably null
Transcript: ENSMUST00000074067
AA Change: Y351*
SMART Domains Protein: ENSMUSP00000073709
Gene: ENSMUSG00000064140
AA Change: Y351*

DomainStartEndE-ValueType
RING 16 61 8.95e-7 SMART
BBOX 90 131 4.34e-5 SMART
coiled coil region 202 249 N/A INTRINSIC
PRY 293 347 2.31e-9 SMART
SPRY 348 469 6.71e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144770
Predicted Effect probably benign
Transcript: ENSMUST00000223911
Predicted Effect probably null
Transcript: ENSMUST00000226039
AA Change: Y351*
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The encoded protein contains a RING-type zinc finger, B box-type zinc finger and SPRY domain. The function of this protein has not been identified. A pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased poly(I:C) and LPS-induced IFN-beta, TNFalpha and IL6 with increased induced mortality induced by poly(I:C), LPS or S. typhimurium infection, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Trim38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Trim38 APN 13 23791032 missense possibly damaging 0.91
IGL01592:Trim38 APN 13 23791427 missense possibly damaging 0.85
IGL02339:Trim38 APN 13 23788230 missense probably damaging 1.00
IGL03062:Trim38 APN 13 23782963 missense probably damaging 1.00
IGL03278:Trim38 APN 13 23790996 missense possibly damaging 0.65
R1263:Trim38 UTSW 13 23791134 missense probably damaging 1.00
R1560:Trim38 UTSW 13 23782702 missense probably benign 0.02
R1978:Trim38 UTSW 13 23791098 missense probably damaging 1.00
R4407:Trim38 UTSW 13 23791491 missense probably benign 0.04
R4462:Trim38 UTSW 13 23791452 missense probably null 1.00
R4649:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4651:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4653:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4816:Trim38 UTSW 13 23788281 missense probably damaging 1.00
R4970:Trim38 UTSW 13 23791329 missense probably damaging 0.98
R5946:Trim38 UTSW 13 23782734 missense probably benign 0.04
R6538:Trim38 UTSW 13 23785949 missense probably damaging 0.97
R6974:Trim38 UTSW 13 23789519 missense probably benign 0.05
R7227:Trim38 UTSW 13 23785963 missense possibly damaging 0.88
R7319:Trim38 UTSW 13 23791401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGTCAGCGTGATCCTGGACC -3'
(R):5'- AAGGGCCTCAGAGTATCCTGGAAG -3'

Sequencing Primer
(F):5'- TGATCCTGGACCCCAGC -3'
(R):5'- CAGAATCTGGGGCTTTTCAATC -3'
Posted On2013-07-11