Incidental Mutation 'R0631:Arid1a'
ID57931
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
MMRRC Submission 038820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0631 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133689170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1098 (I1098T)
Ref Sequence ENSEMBL: ENSMUSP00000122354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000145664]
Predicted Effect unknown
Transcript: ENSMUST00000008024
AA Change: I713T
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880
AA Change: I713T

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105897
AA Change: I1098T
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880
AA Change: I1098T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138473
Predicted Effect unknown
Transcript: ENSMUST00000145664
AA Change: I1098T
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880
AA Change: I1098T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T A 9: 51,101,953 R6S probably benign Het
Aadat T C 8: 60,529,445 probably benign Het
Afap1l2 T C 19: 56,916,085 E594G probably benign Het
Ak8 T G 2: 28,735,665 I240S probably damaging Het
Akap13 T C 7: 75,614,996 V174A probably damaging Het
Alppl2 G A 1: 87,089,373 T66I probably damaging Het
Ankrd61 T A 5: 143,894,879 I36F probably damaging Het
Antxrl T A 14: 34,058,801 probably null Het
Arhgef2 G C 3: 88,634,436 V244L probably damaging Het
Atr T C 9: 95,874,777 V903A possibly damaging Het
AW549877 A G 15: 3,986,489 probably benign Het
B3gnt6 C A 7: 98,193,692 A354S probably benign Het
Bnc1 A T 7: 81,974,366 I371N probably damaging Het
Camsap1 A T 2: 25,933,647 S1464T probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Cass4 T C 2: 172,432,411 I728T probably damaging Het
Ccdc88a A T 11: 29,493,752 M1378L probably damaging Het
Ccdc9 C A 7: 16,278,459 W266L probably damaging Het
Cct6b C A 11: 82,737,088 probably null Het
Cd177 T C 7: 24,756,686 E219G probably benign Het
Cdkal1 A T 13: 29,354,684 Y497* probably null Het
Chmp2a T C 7: 13,032,444 E107G probably damaging Het
Chrna2 T G 14: 66,149,308 V301G probably benign Het
Chrna7 A G 7: 63,099,643 C364R probably benign Het
Cltc G T 11: 86,712,613 L796I probably benign Het
Col12a1 T C 9: 79,703,376 T249A probably damaging Het
Col13a1 G A 10: 61,887,350 Q270* probably null Het
Col6a1 C T 10: 76,709,735 V968M probably benign Het
Copb1 C A 7: 114,233,282 V511F probably benign Het
Daw1 C G 1: 83,197,260 S160R probably damaging Het
Ddx46 A G 13: 55,639,777 probably benign Het
Depdc7 T C 2: 104,721,987 K492E possibly damaging Het
Dmbt1 C T 7: 131,097,653 A1004V possibly damaging Het
Dnah7b G A 1: 46,240,992 V2694I probably benign Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Edc4 C A 8: 105,890,792 A1052E possibly damaging Het
Eif2s2 T A 2: 154,884,358 K129M probably damaging Het
Emx2 A G 19: 59,464,028 D248G probably damaging Het
Erich6b T C 14: 75,659,009 probably benign Het
Exoc3l4 A G 12: 111,427,966 K507E probably benign Het
Fanci T A 7: 79,406,205 V195E probably damaging Het
Fgfr2 T G 7: 130,227,239 probably benign Het
Frem1 A G 4: 82,972,165 S1007P probably damaging Het
Fry T C 5: 150,496,352 I993T possibly damaging Het
Fst A G 13: 114,454,502 S244P possibly damaging Het
Gcc1 T C 6: 28,421,010 T103A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gja3 T C 14: 57,036,762 D51G possibly damaging Het
Gm10305 A G 4: 99,273,076 D74G unknown Het
Gm12689 G T 4: 99,296,021 G37V unknown Het
Gm5424 C T 10: 62,071,534 noncoding transcript Het
Hephl1 T C 9: 15,084,524 E434G probably benign Het
Htatip2 T C 7: 49,773,311 C205R possibly damaging Het
Igf2r T C 17: 12,717,274 probably null Het
Ints2 T C 11: 86,233,196 I589V probably benign Het
Itgae T A 11: 73,114,907 V299D probably damaging Het
Kcnma1 T C 14: 23,509,784 probably benign Het
Kif11 A G 19: 37,413,117 probably benign Het
Kif13a A G 13: 46,778,888 probably benign Het
Kif18a T A 2: 109,298,322 probably benign Het
Klhl29 T C 12: 5,094,883 T406A probably benign Het
Litaf A T 16: 10,966,412 probably benign Het
Lmntd1 T A 6: 145,430,000 I71F probably benign Het
Lrit3 A C 3: 129,788,555 C594W probably damaging Het
Lrp6 T A 6: 134,479,775 Q842L possibly damaging Het
Lrrcc1 T A 3: 14,540,119 probably benign Het
Macf1 A T 4: 123,455,524 L1829* probably null Het
Mapk1ip1 T C 7: 138,835,955 T249A possibly damaging Het
Mfap4 T C 11: 61,487,180 F173L probably damaging Het
Mfsd9 C A 1: 40,790,474 probably benign Het
Mgat4b T C 11: 50,230,763 S69P probably damaging Het
Mki67 A T 7: 135,704,388 V620D probably damaging Het
Moxd1 C T 10: 24,252,954 T201I probably damaging Het
Msh4 G C 3: 153,866,420 D774E probably benign Het
Myg1 C T 15: 102,331,849 R37C probably benign Het
Myrf C A 19: 10,228,882 A57S probably benign Het
Ndst1 G A 18: 60,700,359 probably benign Het
Nedd4l A T 18: 65,208,503 probably benign Het
Neil2 T A 14: 63,183,400 I281F possibly damaging Het
Nfatc2 T A 2: 168,590,115 D26V probably benign Het
Nt5c A G 11: 115,490,714 probably null Het
Olfr1095 T C 2: 86,850,967 T244A probably benign Het
Olfr1369-ps1 G T 13: 21,115,908 C72F probably damaging Het
Olfr202 A G 16: 59,284,207 C97R possibly damaging Het
Olfr372 T A 8: 72,058,322 I214N probably damaging Het
Olfr538 T G 7: 140,574,507 M118R probably damaging Het
Ovch2 A G 7: 107,782,021 S557P probably benign Het
Pik3cg A G 12: 32,205,203 S262P probably benign Het
Pla2g6 T A 15: 79,306,396 H322L probably damaging Het
Plch1 A T 3: 63,699,219 L1079Q probably benign Het
Plekhg4 T A 8: 105,379,302 V777D probably damaging Het
Plekhg5 A G 4: 152,112,419 D747G possibly damaging Het
Poln C A 5: 34,118,958 V318F possibly damaging Het
Pou5f2 T A 13: 78,025,754 S272T probably benign Het
Ppp1r3e T G 14: 54,876,616 S200R possibly damaging Het
Prl7d1 G A 13: 27,710,182 P135S probably benign Het
Ptgs2 G A 1: 150,104,537 V409I probably benign Het
Ptk2b T C 14: 66,177,751 T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 T747A probably damaging Het
Qrfpr A G 3: 36,221,989 I84T probably damaging Het
Rab44 A G 17: 29,139,144 D102G possibly damaging Het
Rnf125 A T 18: 20,979,083 D57V possibly damaging Het
Rnf145 T C 11: 44,560,024 F392L probably damaging Het
Rttn A G 18: 88,989,546 N435S probably benign Het
Scn8a A G 15: 101,035,537 T1500A probably damaging Het
Sgsm1 A G 5: 113,285,123 probably benign Het
Sgsm3 A T 15: 81,011,736 *751C probably null Het
Slc35c2 A C 2: 165,280,929 L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 E396V probably damaging Het
Smarca4 G C 9: 21,658,984 probably benign Het
Snapc3 T A 4: 83,417,802 V17D probably damaging Het
Snta1 G T 2: 154,377,072 Q448K probably benign Het
Sptbn2 A G 19: 4,739,986 D1334G probably benign Het
Stard5 A G 7: 83,632,757 R41G probably damaging Het
Stxbp5 T A 10: 9,784,358 N731I probably benign Het
Tmem135 T A 7: 89,143,788 K413* probably null Het
Tmem38a G A 8: 72,580,018 V114I probably benign Het
Tpr A G 1: 150,422,531 T1057A probably damaging Het
Ttc23l A T 15: 10,539,980 L139Q probably damaging Het
Ttn T A 2: 76,755,296 probably null Het
Tuba3b A G 6: 145,619,576 T257A probably damaging Het
Tubgcp6 A C 15: 89,100,987 Y1633D probably damaging Het
Txnl1 C T 18: 63,671,573 probably benign Het
Unc13b A G 4: 43,182,849 Q3186R possibly damaging Het
Vmn2r75 T A 7: 86,163,270 S514C probably null Het
Whrn G A 4: 63,419,489 T545I probably damaging Het
Zdhhc20 T C 14: 57,857,640 H154R probably damaging Het
Zfp462 A T 4: 55,007,563 M1L possibly damaging Het
Zfp831 A G 2: 174,645,290 K586R possibly damaging Het
Zfp990 A T 4: 145,537,302 H290L possibly damaging Het
Zfpm1 C T 8: 122,336,874 probably benign Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
PIT4520001:Arid1a UTSW 4 133681916 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0648:Arid1a UTSW 4 133685204 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R1960:Arid1a UTSW 4 133753090 missense possibly damaging 0.84
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5412:Arid1a UTSW 4 133719602 unclassified probably benign
R5540:Arid1a UTSW 4 133680454 missense unknown
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
X0064:Arid1a UTSW 4 133689260 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGTCTGCCAAACTGCCAAGCC -3'
(R):5'- GTTCAGCACCTGTGAACTGGAAGG -3'

Sequencing Primer
(F):5'- CAGTACCTAAGGAAGTGTGCTCTC -3'
(R):5'- ACTGGAAGGCTGGGTCATC -3'
Posted On2013-07-11