Mutagenetix > Incidental Mutation

Incidental Mutation 'R7482:Cntnap4'

579863

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

Caspr4, E130114F09Rik

MMRRC Submission

045556-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R7482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113296675-113609349 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 113460194 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000034225] [ENSMUST00000118171] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably null
Transcript: ENSMUST00000034225

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000034225

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000118171

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000118171

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	G	A	13: 111,392,673 (GRCm39)	R336H	probably damaging	Het
Akap9	C	G	5: 4,018,745 (GRCm39)	H1109D	probably benign	Het
Ap2a2	C	T	7: 141,182,210 (GRCm39)	P180S	possibly damaging	Het
Arfgef2	T	C	2: 166,693,199 (GRCm39)		probably null	Het
Arhgef25	A	T	10: 127,021,540 (GRCm39)	M226K	probably damaging	Het
Brd7	T	C	8: 89,088,254 (GRCm39)	D45G	probably damaging	Het
Bsn	C	A	9: 107,990,728 (GRCm39)	V1675F	probably damaging	Het
Chtf18	C	A	17: 25,938,963 (GRCm39)	R820L	possibly damaging	Het
Cldn7	A	G	11: 69,856,865 (GRCm39)	D38G	possibly damaging	Het
Clpb	T	C	7: 101,435,926 (GRCm39)	V615A	possibly damaging	Het
Dchs2	T	A	3: 83,156,032 (GRCm39)	S798T	possibly damaging	Het
Ect2l	A	T	10: 18,044,202 (GRCm39)	M311K	probably benign	Het
Hectd4	T	A	5: 121,501,941 (GRCm39)	C4225S	possibly damaging	Het
Hecw2	T	C	1: 54,079,629 (GRCm39)	H8R	probably damaging	Het
Hif3a	G	A	7: 16,776,560 (GRCm39)	T462I	possibly damaging	Het
Itgb2l	T	C	16: 96,228,033 (GRCm39)	E490G	probably benign	Het
Jakmip3	T	A	7: 138,627,228 (GRCm39)	C411S	possibly damaging	Het
Klhl24	A	G	16: 19,933,405 (GRCm39)	T339A	possibly damaging	Het
Mctp1	A	T	13: 76,889,579 (GRCm39)		probably null	Het
Mlf1	T	A	3: 67,300,227 (GRCm39)	H81Q	probably benign	Het
Muc4	T	A	16: 32,587,324 (GRCm39)	Y652N		Het
Myo9b	A	G	8: 71,795,442 (GRCm39)	S804G	probably benign	Het
Or8b1	T	G	9: 38,399,747 (GRCm39)	C141G	probably damaging	Het
Pramel58	T	C	5: 94,830,739 (GRCm39)	I79T	possibly damaging	Het
Rab11fip5	T	C	6: 85,317,760 (GRCm39)	E1043G	probably benign	Het
Radil	A	G	5: 142,472,518 (GRCm39)	V941A	probably benign	Het
Senp8	A	G	9: 59,644,943 (GRCm39)	V71A	probably damaging	Het
Sh2d4a	G	A	8: 68,749,328 (GRCm39)	A121T	probably benign	Het
Stx17	A	G	4: 48,181,722 (GRCm39)	D297G	possibly damaging	Het
Tas2r105	A	T	6: 131,663,972 (GRCm39)	M152K	probably benign	Het
Tlr11	G	T	14: 50,600,456 (GRCm39)	C814F	probably damaging	Het
Tsc22d1	T	C	14: 76,655,927 (GRCm39)	V802A	probably benign	Het
Vmn1r234	A	G	17: 21,449,637 (GRCm39)	N184D	probably benign	Het
Vmn2r114	T	C	17: 23,510,468 (GRCm39)	K671E	probably damaging	Het
Vmn2r27	A	G	6: 124,201,220 (GRCm39)	F246L	probably damaging	Het
Xpo1	T	G	11: 23,232,544 (GRCm39)	L355V	probably benign	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	113,494,251 (GRCm39)	splice site	probably benign
IGL01898:Cntnap4	APN	8	113,582,939 (GRCm39)	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	113,478,866 (GRCm39)	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	113,343,126 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	113,512,535 (GRCm39)	splice site	probably benign
IGL02621:Cntnap4	APN	8	113,537,355 (GRCm39)	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	113,500,222 (GRCm39)	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	113,512,416 (GRCm39)	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	113,569,148 (GRCm39)	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	113,583,143 (GRCm39)	nonsense	probably null
R0497:Cntnap4	UTSW	8	113,296,783 (GRCm39)	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	113,608,395 (GRCm39)	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	113,608,462 (GRCm39)	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	113,484,155 (GRCm39)	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	113,542,128 (GRCm39)	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	113,484,203 (GRCm39)	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	113,484,071 (GRCm39)	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	113,478,939 (GRCm39)	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	113,480,554 (GRCm39)	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	113,391,898 (GRCm39)	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	113,584,842 (GRCm39)	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	113,537,240 (GRCm39)	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	113,537,342 (GRCm39)	missense	probably benign
R4611:Cntnap4	UTSW	8	113,500,371 (GRCm39)	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	113,512,468 (GRCm39)	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	113,460,070 (GRCm39)	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	113,568,385 (GRCm39)	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	113,602,061 (GRCm39)	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	113,569,353 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	113,529,843 (GRCm39)	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	113,478,921 (GRCm39)	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	113,484,105 (GRCm39)	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	113,529,858 (GRCm39)	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	113,584,874 (GRCm39)	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	113,537,268 (GRCm39)	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	113,608,432 (GRCm39)	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	113,391,731 (GRCm39)	splice site	probably null
R7348:Cntnap4	UTSW	8	113,391,909 (GRCm39)	missense	probably damaging	1.00
R7832:Cntnap4	UTSW	8	113,484,113 (GRCm39)	missense	probably benign
R7895:Cntnap4	UTSW	8	113,478,829 (GRCm39)	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	113,480,577 (GRCm39)	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	113,391,897 (GRCm39)	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	113,296,857 (GRCm39)	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	113,500,324 (GRCm39)	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	113,484,228 (GRCm39)	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	113,585,759 (GRCm39)	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	113,479,598 (GRCm39)	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	113,479,646 (GRCm39)	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	113,602,600 (GRCm39)	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	113,500,276 (GRCm39)	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	113,460,103 (GRCm39)	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	113,582,982 (GRCm39)	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	113,602,181 (GRCm39)	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	113,568,349 (GRCm39)	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	113,391,808 (GRCm39)	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	113,568,496 (GRCm39)	missense	probably damaging	0.97
R9765:Cntnap4	UTSW	8	113,484,110 (GRCm39)	missense	probably benign	0.00
R9793:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	113,542,152 (GRCm39)	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	113,584,821 (GRCm39)	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	113,479,002 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGCTGACAACCTCCAGATAGAG -3'
(R):5'- CGTGCTTCATCCCTGAATTAAAATG -3'

Sequencing Primer
(F):5'- TGACAACCTCCAGATAGAGATCCTTC -3'
(R):5'- ACTGGAGTCATTCCTGTC -3'

Posted On

2019-10-07