Incidental Mutation 'R0633:Lpin3'
ID58048
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Namelipin 3
Synonyms9130206L11Rik
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160880670-160906002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160903974 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 675 (H675R)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040872
AA Change: H665R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: H665R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109455
AA Change: H634R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: H634R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109456
AA Change: H665R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: H665R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109457
AA Change: H675R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: H675R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGACATAGATGGCACCATCACC -3'
(R):5'- GCTGACTCACACAAGGACTAAGGAC -3'

Sequencing Primer
(F):5'- TAGATGGCACCATCACCAAGTG -3'
(R):5'- CAGGAAGGTTTTATGGACTTCCC -3'
Posted On2013-07-11