Incidental Mutation 'R0633:Ptgfr'
ID58052
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Nameprostaglandin F receptor
SynonymsFP, PGF
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location151796502-151837630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151801763 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 321 (R321H)
Ref Sequence ENSEMBL: ENSMUSP00000101732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
Predicted Effect probably benign
Transcript: ENSMUST00000029670
AA Change: R321H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: R321H

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106126
AA Change: R321H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: R321H

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128349
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151835686 missense probably benign 0.43
IGL02085:Ptgfr APN 3 151835800 missense probably benign 0.00
IGL02110:Ptgfr APN 3 151835460 missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151835326 missense probably benign 0.00
IGL03263:Ptgfr APN 3 151835863 missense probably benign 0.00
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R1614:Ptgfr UTSW 3 151801779 missense probably benign 0.44
R1930:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1931:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1989:Ptgfr UTSW 3 151835339 nonsense probably null
R4596:Ptgfr UTSW 3 151801793 missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151835101 missense probably damaging 0.96
R6295:Ptgfr UTSW 3 151835289 missense probably benign 0.00
R6907:Ptgfr UTSW 3 151835301 missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151835541 missense possibly damaging 0.74
R7320:Ptgfr UTSW 3 151835397 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GTGTCTGACCAGTGTTCTCCCAAAC -3'
(R):5'- CATGGCAGCACTTTGTGAGATGTG -3'

Sequencing Primer
(F):5'- GGTCCAAATGTTCCAGTTACACG -3'
(R):5'- GTTGTCAACTTGAAAAACTGTGGG -3'
Posted On2013-07-11