Incidental Mutation 'R0633:Lgi2'
ID58059
Institutional Source Beutler Lab
Gene Symbol Lgi2
Ensembl Gene ENSMUSG00000039252
Gene Nameleucine-rich repeat LGI family, member 2
Synonyms
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location52533517-52566462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52554460 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 173 (Y173H)
Ref Sequence ENSEMBL: ENSMUSP00000040436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039750] [ENSMUST00000199942]
Predicted Effect probably damaging
Transcript: ENSMUST00000039750
AA Change: Y173H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040436
Gene: ENSMUSG00000039252
AA Change: Y173H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 9e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRRCT 140 189 4.49e-4 SMART
Pfam:EPTP 224 265 3.9e-12 PFAM
Pfam:EPTP 270 311 2e-13 PFAM
Pfam:EPTP 316 362 2.1e-16 PFAM
Pfam:EPTP 365 407 2.3e-9 PFAM
Pfam:EPTP 412 454 4.8e-12 PFAM
Pfam:EPTP 457 498 2.7e-14 PFAM
low complexity region 499 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199942
AA Change: Y197H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143707
Gene: ENSMUSG00000039252
AA Change: Y197H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 7e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRR_TYP 129 152 5.99e-4 SMART
LRRCT 164 213 4.49e-4 SMART
Pfam:EPTP 216 257 5.6e-12 PFAM
Pfam:EPTP 262 303 2.8e-13 PFAM
Pfam:EPTP 308 354 3e-16 PFAM
Pfam:EPTP 357 399 3.3e-9 PFAM
Pfam:EPTP 404 446 6.8e-12 PFAM
Pfam:EPTP 449 490 3.8e-14 PFAM
low complexity region 491 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Lgi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lgi2 APN 5 52538121 missense probably benign
IGL01310:Lgi2 APN 5 52554465 missense probably benign 0.44
IGL02086:Lgi2 APN 5 52565957 missense probably damaging 0.96
IGL03091:Lgi2 APN 5 52563965 critical splice donor site probably null
IGL03367:Lgi2 APN 5 52562160 missense probably damaging 1.00
IGL03388:Lgi2 APN 5 52538477 missense probably damaging 1.00
R0388:Lgi2 UTSW 5 52554549 missense probably damaging 0.99
R0602:Lgi2 UTSW 5 52554423 missense probably damaging 0.98
R1616:Lgi2 UTSW 5 52546638 missense probably benign 0.00
R1916:Lgi2 UTSW 5 52546632 missense probably benign
R2072:Lgi2 UTSW 5 52538505 missense probably damaging 1.00
R2512:Lgi2 UTSW 5 52537965 makesense probably null
R4614:Lgi2 UTSW 5 52538433 missense probably damaging 0.99
R4855:Lgi2 UTSW 5 52538507 missense probably damaging 1.00
R5092:Lgi2 UTSW 5 52538087 missense probably damaging 1.00
R5181:Lgi2 UTSW 5 52554450 missense probably damaging 1.00
R5311:Lgi2 UTSW 5 52554485 missense probably damaging 0.99
R6074:Lgi2 UTSW 5 52546642 missense probably benign
R7089:Lgi2 UTSW 5 52538490 missense probably damaging 0.99
R7376:Lgi2 UTSW 5 52538262 missense probably damaging 0.99
R7396:Lgi2 UTSW 5 52538411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGAGATGTTCTCCGAACCCC -3'
(R):5'- accagccagtacaACTAACCAAAGC -3'

Sequencing Primer
(F):5'- tcacttctcaccttcaaccac -3'
(R):5'- ccagtacaACTAACCAAAGCACATC -3'
Posted On2013-07-11