Incidental Mutation 'R0633:Mitf'
ID58063
Institutional Source Beutler Lab
Gene Symbol Mitf
Ensembl Gene ENSMUSG00000035158
Gene Namemelanogenesis associated transcription factor
Synonymswh, mi, Gsfbcc2, bHLHe32, BCC2
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0633 (G1)
Quality Score169
Status Not validated
Chromosome6
Chromosomal Location97807052-98021349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98003904 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 97 (N97K)
Ref Sequence ENSEMBL: ENSMUSP00000144988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043628
AA Change: N153K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: N153K

DomainStartEndE-ValueType
HLH 210 263 5.53e-17 SMART
Pfam:DUF3371 290 416 9.5e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043637
AA Change: N260K

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158
AA Change: N260K

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 3.1e-52 PFAM
HLH 317 370 5.53e-17 SMART
Pfam:DUF3371 397 522 2.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101123
AA Change: N244K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158
AA Change: N244K

DomainStartEndE-ValueType
coiled coil region 44 74 N/A INTRINSIC
HLH 301 354 5.53e-17 SMART
Pfam:DUF3371 381 507 4.8e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113339
AA Change: N235K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158
AA Change: N235K

DomainStartEndE-ValueType
coiled coil region 35 65 N/A INTRINSIC
HLH 292 345 5.53e-17 SMART
Pfam:DUF3371 372 498 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139462
Predicted Effect possibly damaging
Transcript: ENSMUST00000203884
AA Change: N260K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158
AA Change: N260K

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 2.2e-49 PFAM
HLH 311 364 2.3e-19 SMART
Pfam:DUF3371 391 516 1.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203938
AA Change: N97K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: N97K

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 7 60 2.2e-7 PFAM
HLH 148 201 2.3e-19 SMART
Pfam:DUF3371 228 353 9.2e-36 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Mitf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Mitf APN 6 98017931 missense possibly damaging 0.69
IGL01516:Mitf APN 6 98010390 splice site probably null
IGL01617:Mitf APN 6 97996428 missense probably benign 0.00
IGL01875:Mitf APN 6 98017895 missense probably benign 0.22
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0079:Mitf UTSW 6 97996440 missense probably benign 0.00
R0381:Mitf UTSW 6 97993143 missense probably damaging 1.00
R0494:Mitf UTSW 6 97994429 missense probably benign 0.00
R0829:Mitf UTSW 6 98003908 missense possibly damaging 0.46
R1189:Mitf UTSW 6 98006125 missense possibly damaging 0.67
R1459:Mitf UTSW 6 98010467 missense probably damaging 1.00
R1766:Mitf UTSW 6 97941099 missense probably damaging 1.00
R1864:Mitf UTSW 6 98010422 missense probably damaging 1.00
R1891:Mitf UTSW 6 97941276 missense probably benign 0.00
R3934:Mitf UTSW 6 97993253 missense probably damaging 1.00
R3936:Mitf UTSW 6 97993253 missense probably damaging 1.00
R4323:Mitf UTSW 6 97991949 missense probably benign 0.12
R5052:Mitf UTSW 6 98010445 missense possibly damaging 0.91
R5097:Mitf UTSW 6 97996462 missense possibly damaging 0.63
R5297:Mitf UTSW 6 97994430 missense probably benign 0.09
R5646:Mitf UTSW 6 98013694 missense probably damaging 1.00
R6109:Mitf UTSW 6 97996468 missense probably damaging 1.00
R6351:Mitf UTSW 6 98003912 missense possibly damaging 0.85
R6411:Mitf UTSW 6 98010472 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAATGTGCCCACCAGACAGAAG -3'
(R):5'- TGCTGTTCCGTTGGTAACGCTC -3'

Sequencing Primer
(F):5'- AATTCTGTGTGAGTCCTCAGAC -3'
(R):5'- GTAACGCTCCCCAGTGG -3'
Posted On2013-07-11