Incidental Mutation 'R0633:Ddx25'
ID58084
Institutional Source Beutler Lab
Gene Symbol Ddx25
Ensembl Gene ENSMUSG00000032101
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 25
SynonymsGRTH
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35536647-35558528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35545972 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 349 (R349L)
Ref Sequence ENSEMBL: ENSMUSP00000034612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612]
Predicted Effect probably damaging
Transcript: ENSMUST00000034612
AA Change: R349L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101
AA Change: R349L

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrest of spermatogenesis at step 8, abnormal Leydig cells, and increased germ cell apoptosis in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Ddx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ddx25 APN 9 35543595 splice site probably benign
IGL00951:Ddx25 APN 9 35552835 critical splice donor site probably null
IGL02237:Ddx25 APN 9 35542069 splice site probably benign
IGL02270:Ddx25 APN 9 35554412 splice site probably benign
IGL02273:Ddx25 APN 9 35546826 missense possibly damaging 0.95
IGL02325:Ddx25 APN 9 35554508 unclassified probably benign
IGL02422:Ddx25 APN 9 35551364 missense probably null 1.00
IGL02440:Ddx25 APN 9 35557678 unclassified probably benign
IGL02798:Ddx25 APN 9 35551397 missense probably damaging 1.00
IGL03339:Ddx25 APN 9 35542003 missense probably damaging 1.00
R0893:Ddx25 UTSW 9 35554390 nonsense probably null
R1171:Ddx25 UTSW 9 35546846 nonsense probably null
R1448:Ddx25 UTSW 9 35557738 missense probably benign
R1453:Ddx25 UTSW 9 35542002 missense probably damaging 1.00
R1582:Ddx25 UTSW 9 35545976 missense probably damaging 0.97
R3055:Ddx25 UTSW 9 35551351 missense probably damaging 1.00
R5960:Ddx25 UTSW 9 35554511 splice site probably null
R7425:Ddx25 UTSW 9 35554586 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCAACGCCCAGCTTTGACATAC -3'
(R):5'- AAGGTCAGCTCTGCTCCAGGATAG -3'

Sequencing Primer
(F):5'- TCTGAATGATGGAAGCTCGC -3'
(R):5'- gaggaggaggaggtggaag -3'
Posted On2013-07-11