Incidental Mutation 'R0633:Atat1'
ID58108
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35901423 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 305 (R305C)
Ref Sequence ENSEMBL: ENSMUSP00000122715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000146451] [ENSMUST00000148482] [ENSMUST00000148721] [ENSMUST00000149277] [ENSMUST00000150056] [ENSMUST00000156817]
Predicted Effect probably damaging
Transcript: ENSMUST00000056034
AA Change: R282C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: R282C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061052
AA Change: R305C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: R305C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077494
AA Change: R282C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: R282C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126744
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137069
Predicted Effect unknown
Transcript: ENSMUST00000140292
AA Change: R99C
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426
AA Change: R99C

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140990
Predicted Effect probably benign
Transcript: ENSMUST00000141132
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141662
AA Change: R305C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: R305C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143114
Predicted Effect probably benign
Transcript: ENSMUST00000146451
SMART Domains Protein: ENSMUSP00000115771
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148482
SMART Domains Protein: ENSMUSP00000114151
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148721
SMART Domains Protein: ENSMUSP00000116278
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 28 79 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF2358 149 274 1.4e-36 PFAM
low complexity region 289 302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149277
AA Change: R305C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: R305C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149452
Predicted Effect probably benign
Transcript: ENSMUST00000150056
SMART Domains Protein: ENSMUSP00000121142
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 130 5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154272
Predicted Effect probably benign
Transcript: ENSMUST00000156817
SMART Domains Protein: ENSMUSP00000114851
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 16 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R1541:Atat1 UTSW 17 35904331 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2054:Atat1 UTSW 17 35901369 missense probably null 0.99
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R6380:Atat1 UTSW 17 35908957 unclassified probably null
R7010:Atat1 UTSW 17 35908630 missense probably damaging 1.00
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTATCCCCAGCAATGTTAACC -3'
(R):5'- TTCCCAGTCCTGAAGGTAGCTGTG -3'

Sequencing Primer
(F):5'- TGACCCTCGAAATATAACTCTGG -3'
(R):5'- AAGGTAGCTGTGGAGCCTC -3'
Posted On2013-07-11