Incidental Mutation 'R0633:Wdr7'
ID58113
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene NameWD repeat domain 7
SynonymsTGF-beta resistance associated gene, TRAG
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location63708695-63989760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63865300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1106 (V1106A)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
Predicted Effect probably benign
Transcript: ENSMUST00000072726
AA Change: V1106A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: V1106A

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0014:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0931:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5280:Wdr7 UTSW 18 63987312 missense probably benign 0.35
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6234:Wdr7 UTSW 18 63724132 missense probably damaging 1.00
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
R7162:Wdr7 UTSW 18 63724139 missense possibly damaging 0.92
R7376:Wdr7 UTSW 18 63777620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTCCATCTGTGTGAATCAGTGAC -3'
(R):5'- ACCCAGAGTGGTCCTGTTTCCTAAC -3'

Sequencing Primer
(F):5'- GTGAATCAGTGACATATTCTTGTCCC -3'
(R):5'- CCATCAAGGTGATCTGAGGACTTAC -3'
Posted On2013-07-11