Incidental Mutation 'R0008:Sh2d3c'
ID58189
Institutional Source Beutler Lab
Gene Symbol Sh2d3c
Ensembl Gene ENSMUSG00000059013
Gene NameSH2 domain containing 3C
SynonymsChat, Cas/HEF1-associated signal transducer, Nsp3, Shep1, SH2-containing Eph receptor-binding protein 1
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0008 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32721055-32755512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 32753021 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 587 (H587D)
Ref Sequence ENSEMBL: ENSMUSP00000108868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009707] [ENSMUST00000074248] [ENSMUST00000091059] [ENSMUST00000113242] [ENSMUST00000156617] [ENSMUST00000175763] [ENSMUST00000177382]
Predicted Effect probably benign
Transcript: ENSMUST00000009707
SMART Domains Protein: ENSMUSP00000009707
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 160 1.2e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074248
AA Change: H739D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073866
Gene: ENSMUSG00000059013
AA Change: H739D

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
low complexity region 22 43 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
low complexity region 190 207 N/A INTRINSIC
SH2 213 301 7.8e-21 SMART
low complexity region 333 348 N/A INTRINSIC
low complexity region 400 415 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
RasGEF 576 849 8.18e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113242
AA Change: H587D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108868
Gene: ENSMUSG00000059013
AA Change: H587D

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
SH2 61 149 7.8e-21 SMART
low complexity region 181 196 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
RasGEF 424 697 8.18e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123624
Predicted Effect probably benign
Transcript: ENSMUST00000140999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149720
Predicted Effect probably benign
Transcript: ENSMUST00000156617
SMART Domains Protein: ENSMUSP00000122251
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175763
SMART Domains Protein: ENSMUSP00000135701
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177382
SMART Domains Protein: ENSMUSP00000134968
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 101 1.4e-25 PFAM
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with absence of gastric milk. Surviving mice exhibit abnormal olfactory bulb innervation, fewer gonadotrophin positive cells in the hypothalamus, and decreased testes size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Sh2d3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Sh2d3c APN 2 32725084 missense probably benign 0.00
IGL02326:Sh2d3c APN 2 32749151 critical splice acceptor site probably null
IGL03325:Sh2d3c APN 2 32725258 missense probably benign 0.00
R0564:Sh2d3c UTSW 2 32753052 missense probably damaging 0.99
R0619:Sh2d3c UTSW 2 32753025 missense probably damaging 1.00
R1138:Sh2d3c UTSW 2 32749405 missense probably benign 0.00
R1984:Sh2d3c UTSW 2 32749244 nonsense probably null
R3808:Sh2d3c UTSW 2 32746096 missense probably damaging 1.00
R4399:Sh2d3c UTSW 2 32746160 missense probably damaging 0.97
R4556:Sh2d3c UTSW 2 32753009 missense possibly damaging 0.81
R4840:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R5027:Sh2d3c UTSW 2 32744802 missense possibly damaging 0.95
R5367:Sh2d3c UTSW 2 32745902 missense probably damaging 1.00
R6754:Sh2d3c UTSW 2 32754530 missense probably damaging 1.00
R6916:Sh2d3c UTSW 2 32752653 nonsense probably null
R7029:Sh2d3c UTSW 2 32754569 makesense probably null
R7047:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
Predicted Primers PCR Primer
(F):5'- AAGCCTTTCCTCAAGAGCCTGAAC -3'
(R):5'- AGCTACTCACCTTGCAGCTTGACC -3'

Sequencing Primer
(F):5'- CTATGGGTTCCCAAAGACTTCTGAG -3'
(R):5'- TGCAGCTTGACCTCAGC -3'
Posted On2013-07-11