Incidental Mutation 'R0008:Lrp6'
ID58213
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0008 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134485753 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 648 (E648G)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: E648G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: E648G

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGCAGATCGCCCAGTTAAACC -3'
(R):5'- CTAACCCCTGTGCTGAGGACAATG -3'

Sequencing Primer
(F):5'- GGCAAATGTCTGGCTACAAC -3'
(R):5'- ATGGAGGATGTAGCCATCTTTGC -3'
Posted On2013-07-11