Mutagenetix > Incidental Mutation

Incidental Mutation 'R7512:Grap2'

582178

Institutional Source

Beutler Lab

Gene Symbol

Grap2

Ensembl Gene

ENSMUSG00000042351

Gene Name

GRB2-related adaptor protein 2

Synonyms

P38, Gads, Grb2-related adaptor downstream of Sch, Mona, Grf40, GRB2L, GrbX, GRAP-2, GrpL, GRID

MMRRC Submission

045585-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R7512 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80456798-80537055 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 80532754 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 307 (N307T)

Ref Sequence

ENSEMBL: ENSMUSP00000046532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043149] [ENSMUST00000229980] [ENSMUST00000230856]

AlphaFold

O89100

PDB Structure

Structural Basis for Specific Recognition of an RxxK-containing SLP-76 peptide by the Gads C-terminal SH3 domain [SOLUTION NMR]
MONA/GADS SH3C DOMAIN [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
MONA/GADS SH3C IN COMPLEX WITH HPK DERIVED PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of the C-terminal SH3 domain of the adaptor protein GADS in complex with SLP-76 motif peptide reveals a unique SH3-SH3 interaction [X-RAY DIFFRACTION]
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000043149
AA Change: N307T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000046532
Gene: ENSMUSG00000042351
AA Change: N307T

Domain	Start	End	E-Value	Type
SH3	1	55	3.48e-16	SMART
SH2	56	138	7.49e-32	SMART
low complexity region	193	216	N/A	INTRINSIC
SH3	266	321	4.31e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229980
AA Change: N307T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000230856

Meta Mutation Damage Score

0.2391

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly healthy but display abnormal T cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	T	11: 109,829,275 (GRCm39)	A1395T	probably benign	Het
Ank3	A	G	10: 69,826,691 (GRCm39)	K1787E		Het
Atg2a	C	T	19: 6,310,106 (GRCm39)	A1763V	probably damaging	Het
Bdp1	T	C	13: 100,187,457 (GRCm39)	I1637V	probably benign	Het
C1ra	G	A	6: 124,494,684 (GRCm39)	E316K	probably benign	Het
Camsap3	A	G	8: 3,648,740 (GRCm39)	T20A	probably benign	Het
Ccnt2	T	A	1: 127,730,031 (GRCm39)	S303T	possibly damaging	Het
Cdh3	C	T	8: 107,265,640 (GRCm39)	Q228*	probably null	Het
Col19a1	C	T	1: 24,356,788 (GRCm39)	G632R	probably damaging	Het
Dock2	A	C	11: 34,262,542 (GRCm39)	C938G	possibly damaging	Het
Dync1i1	G	T	6: 5,969,410 (GRCm39)	V412L	possibly damaging	Het
Eif1ad6	G	T	12: 87,668,751 (GRCm39)	E128*	probably null	Het
Entrep2	C	T	7: 64,805,918 (GRCm39)	A52T	probably benign	Het
Fam185a	G	A	5: 21,652,356 (GRCm39)		probably null	Het
Fcho1	A	G	8: 72,169,507 (GRCm39)	L133P	possibly damaging	Het
Galnt12	G	A	4: 47,108,406 (GRCm39)	R181H	possibly damaging	Het
Gen1	A	G	12: 11,310,977 (GRCm39)	V85A	possibly damaging	Het
Gm12185	A	T	11: 48,806,717 (GRCm39)	I158K	probably benign	Het
Gm5624	T	C	14: 44,799,312 (GRCm39)	R82G		Het
H6pd	A	G	4: 150,080,405 (GRCm39)	F147L	probably benign	Het
Haspin	A	T	11: 73,027,418 (GRCm39)	I557N	probably damaging	Het
Hectd4	A	T	5: 121,435,172 (GRCm39)	K961N	possibly damaging	Het
Helz2	A	G	2: 180,872,647 (GRCm39)	M2495T	probably benign	Het
Helz2	A	T	2: 180,877,393 (GRCm39)		probably null	Het
Impdh1	T	C	6: 29,207,168 (GRCm39)	I59V	probably benign	Het
Kcnn1	A	T	8: 71,307,293 (GRCm39)	L200Q	possibly damaging	Het
Kif5c	T	A	2: 49,590,977 (GRCm39)	H276Q	probably damaging	Het
Kntc1	T	C	5: 123,929,001 (GRCm39)	L1259P	probably damaging	Het
Krtap4-1	A	T	11: 99,518,859 (GRCm39)	C50*	probably null	Het
Lat2	T	A	5: 134,634,798 (GRCm39)	D114V	probably damaging	Het
Lrrc41	A	G	4: 115,950,191 (GRCm39)	T535A	possibly damaging	Het
Ly75	A	T	2: 60,164,907 (GRCm39)	V757D	probably damaging	Het
Masp1	C	A	16: 23,288,874 (GRCm39)	R642L	probably damaging	Het
Morn3	A	G	5: 123,175,343 (GRCm39)		probably null	Het
Mpl	A	T	4: 118,306,089 (GRCm39)	I384N		Het
Mtmr14	C	T	6: 113,245,652 (GRCm39)	Q409*	probably null	Het
Nek1	T	A	8: 61,583,179 (GRCm39)	D1272E	probably benign	Het
Oit3	T	C	10: 59,274,716 (GRCm39)	Y28C	probably damaging	Het
Or2z8	T	A	8: 72,812,367 (GRCm39)	I281N	probably damaging	Het
Or4x12-ps1	A	G	2: 89,916,040 (GRCm39)	I255T	possibly damaging	Het
Or5ac22	T	A	16: 59,135,390 (GRCm39)	N127Y	probably damaging	Het
Pcdh15	T	C	10: 74,477,214 (GRCm39)	Y186H	possibly damaging	Het
Pcdhgb1	T	A	18: 37,815,418 (GRCm39)	D636E	probably damaging	Het
Pdgfra	A	T	5: 75,355,675 (GRCm39)	R1062*	probably null	Het
Pds5b	T	C	5: 150,711,807 (GRCm39)	F922L	probably damaging	Het
Pip5k1c	G	A	10: 81,150,953 (GRCm39)		probably null	Het
Ppp2r3d	T	C	9: 101,052,532 (GRCm39)	T226A	possibly damaging	Het
Ptprh	G	A	7: 4,574,780 (GRCm39)	T413I	possibly damaging	Het
Rora	C	A	9: 69,281,367 (GRCm39)	D382E	probably benign	Het
Sacs	T	A	14: 61,441,879 (GRCm39)	N1308K	probably benign	Het
Sgce	C	T	6: 4,707,192 (GRCm39)	D218N	possibly damaging	Het
Slc34a3	A	T	2: 25,122,253 (GRCm39)		probably null	Het
Slit1	T	C	19: 41,589,074 (GRCm39)	Y1471C	probably damaging	Het
Smarca2	G	T	19: 26,661,209 (GRCm39)	V935L	possibly damaging	Het
Smchd1	T	C	17: 71,688,364 (GRCm39)	N1298S	possibly damaging	Het
Sort1	T	A	3: 108,233,323 (GRCm39)		probably null	Het
Spata13	T	C	14: 60,989,226 (GRCm39)	L964P	probably damaging	Het
Spata31h1	G	A	10: 82,128,469 (GRCm39)	L1514F	probably benign	Het
Trav7-6	C	A	14: 53,954,552 (GRCm39)	D47E	probably benign	Het
Ubap2l	A	G	3: 89,917,803 (GRCm39)	F864L	unknown	Het
Vmn2r102	C	T	17: 19,914,363 (GRCm39)	P643S	probably damaging	Het
Zfp112	T	A	7: 23,824,604 (GRCm39)	C195S	possibly damaging	Het
Zfp764l1	C	T	7: 126,992,496 (GRCm39)	C38Y	probably null	Het

Other mutations in Grap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01727:Grap2	APN	15	80,518,610 (GRCm39)	missense	probably damaging	1.00
IGL02121:Grap2	APN	15	80,532,076 (GRCm39)	missense	possibly damaging	0.77
IGL02347:Grap2	APN	15	80,530,557 (GRCm39)	splice site	probably benign
IGL02561:Grap2	APN	15	80,532,049 (GRCm39)	splice site	probably benign
Aquavit	UTSW	15	80,527,874 (GRCm39)	missense	probably damaging	0.97
Grappa	UTSW	15	80,532,723 (GRCm39)	missense	probably damaging	0.98
R1465:Grap2	UTSW	15	80,532,612 (GRCm39)	splice site	probably null
R1465:Grap2	UTSW	15	80,532,612 (GRCm39)	splice site	probably null
R1591:Grap2	UTSW	15	80,532,649 (GRCm39)	missense	probably damaging	1.00
R2050:Grap2	UTSW	15	80,530,444 (GRCm39)	missense	probably benign	0.09
R2862:Grap2	UTSW	15	80,532,165 (GRCm39)	missense	probably damaging	0.98
R3801:Grap2	UTSW	15	80,507,947 (GRCm39)	missense	possibly damaging	0.62
R3804:Grap2	UTSW	15	80,507,947 (GRCm39)	missense	possibly damaging	0.62
R4838:Grap2	UTSW	15	80,522,762 (GRCm39)	missense	possibly damaging	0.92
R5090:Grap2	UTSW	15	80,522,683 (GRCm39)	missense	possibly damaging	0.95
R5119:Grap2	UTSW	15	80,530,345 (GRCm39)	missense	possibly damaging	0.93
R5121:Grap2	UTSW	15	80,530,345 (GRCm39)	missense	possibly damaging	0.93
R6652:Grap2	UTSW	15	80,532,723 (GRCm39)	missense	probably damaging	0.98
R6873:Grap2	UTSW	15	80,527,874 (GRCm39)	missense	probably damaging	0.97
R7082:Grap2	UTSW	15	80,532,699 (GRCm39)	missense	probably benign	0.27
R7571:Grap2	UTSW	15	80,527,905 (GRCm39)	missense	probably damaging	1.00
R8730:Grap2	UTSW	15	80,532,140 (GRCm39)	missense	possibly damaging	0.80
R8833:Grap2	UTSW	15	80,522,684 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGAATAGATCTAGAAGCTCACGGC -3'
(R):5'- TGTGTACTCGGGCACACATG -3'

Sequencing Primer
(F):5'- CCTCTGTGTGATAGTCGTACCAAAG -3'
(R):5'- TTTGGACGAAAAGCCCC -3'

Posted On

2019-10-17