Incidental Mutation 'R0008:Prep'
ID58235
Institutional Source Beutler Lab
Gene Symbol Prep
Ensembl Gene ENSMUSG00000019849
Gene Nameprolyl endopeptidase
Synonymsprolyl oligopeptidase, Pop, D10Wsu136e
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R0008 (G1)
Quality Score212
Status Validated
Chromosome10
Chromosomal Location45067203-45167198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45115078 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 280 (V280A)
Ref Sequence ENSEMBL: ENSMUSP00000097444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099858]
Predicted Effect probably benign
Transcript: ENSMUST00000099858
AA Change: V280A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097444
Gene: ENSMUSG00000019849
AA Change: V280A

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 7 423 1.2e-170 PFAM
Pfam:Peptidase_S9 482 707 1.7e-72 PFAM
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit sex-dependent resistance to diet-induced obesity and adiposity. Mice heterozygous for a gene trap allele exhibit maternal inheritance influenced increase in body weight, organ weight, and adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Prep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prep APN 10 45115173 missense probably damaging 1.00
IGL01412:Prep APN 10 45153112 missense probably damaging 1.00
IGL01577:Prep APN 10 45072048 splice site probably benign
IGL02751:Prep APN 10 45115186 missense probably damaging 1.00
IGL02754:Prep APN 10 45067332 start codon destroyed probably null 0.23
IGL02875:Prep APN 10 45158433 missense probably damaging 1.00
IGL02957:Prep APN 10 45126030 missense probably benign 0.44
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0167:Prep UTSW 10 45158230 critical splice acceptor site probably null
R0396:Prep UTSW 10 45092676 missense probably damaging 1.00
R0828:Prep UTSW 10 45155525 missense probably benign 0.01
R1309:Prep UTSW 10 45126026 missense probably benign
R2166:Prep UTSW 10 45092655 splice site probably benign
R4020:Prep UTSW 10 45092798 splice site probably benign
R4058:Prep UTSW 10 45158371 missense probably benign 0.29
R4162:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4163:Prep UTSW 10 45067340 missense probably benign
R4163:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4328:Prep UTSW 10 45120649 missense probably benign
R4343:Prep UTSW 10 45120770 missense probably damaging 0.99
R4493:Prep UTSW 10 45120819 missense probably benign 0.38
R4495:Prep UTSW 10 45120819 missense probably benign 0.38
R5192:Prep UTSW 10 45153111 missense probably benign 0.28
R5569:Prep UTSW 10 45097437 missense probably benign
R5888:Prep UTSW 10 45067364 missense possibly damaging 0.74
R5999:Prep UTSW 10 45072129 critical splice donor site probably null
R6468:Prep UTSW 10 45115107 missense probably damaging 1.00
R6556:Prep UTSW 10 45158314 frame shift probably null
R6696:Prep UTSW 10 45153078 missense probably damaging 1.00
R6737:Prep UTSW 10 45097495 missense possibly damaging 0.62
R6762:Prep UTSW 10 45148123 critical splice donor site probably null
R6830:Prep UTSW 10 45097501 missense probably benign 0.01
R7105:Prep UTSW 10 45126063 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTTCAATGGCTCCTTGGCAC -3'
(R):5'- GCAAGCACAGTTTCCAAGCAGC -3'

Sequencing Primer
(F):5'- TTGGCACCCACCTACAATTAG -3'
(R):5'- GCTGCCTGCCTTACCTAAGAC -3'
Posted On2013-07-11