Incidental Mutation 'R0616:Utp20'
ID58340
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 038805-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0616 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88770751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1653 (V1653D)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: V1653D

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: V1653D

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,773,656 T198K possibly damaging Het
Abca12 G T 1: 71,302,671 Q1044K probably damaging Het
Abi3bp A T 16: 56,654,070 T723S probably damaging Het
Ackr3 G A 1: 90,214,469 V217I probably benign Het
Acnat2 A G 4: 49,380,269 S370P probably damaging Het
Arap1 A G 7: 101,401,650 R1152G possibly damaging Het
Arhgap15 G A 2: 44,116,717 probably null Het
Arhgap5 C T 12: 52,517,065 T273I possibly damaging Het
BC017158 A T 7: 128,272,631 probably null Het
C1s2 T C 6: 124,628,764 E332G probably damaging Het
Camp G A 9: 109,848,639 R88W probably benign Het
Cdkl2 A G 5: 92,009,004 M564T probably benign Het
Ceacam20 A G 7: 19,970,396 H124R probably benign Het
Cep19 C T 16: 32,104,011 R32C probably damaging Het
Cep295 G A 9: 15,332,322 Q1565* probably null Het
Chd3 T C 11: 69,345,487 E1932G probably damaging Het
Cnr2 G T 4: 135,917,562 W317L probably benign Het
Cntnap5a C T 1: 116,580,549 H1264Y possibly damaging Het
Depdc7 T A 2: 104,727,305 N200I probably benign Het
Dock4 T C 12: 40,704,415 S468P probably benign Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Fam126a T C 5: 23,986,772 T44A probably damaging Het
Fam217a C A 13: 34,913,683 S55I probably benign Het
Fam92a G A 4: 12,168,234 R210* probably null Het
Farp1 G A 14: 121,277,022 R921H probably damaging Het
Fat4 A G 3: 38,942,870 D1746G probably damaging Het
Fbxw5 T C 2: 25,502,505 F100L probably damaging Het
Gli3 C A 13: 15,662,406 T458K possibly damaging Het
Gm4841 T C 18: 60,270,937 Y28C probably benign Het
Gprc5d T C 6: 135,116,432 E159G probably benign Het
Grm4 A T 17: 27,434,564 I757N probably damaging Het
Hagh A G 17: 24,857,577 Y94C probably damaging Het
Itpkb T C 1: 180,421,736 I892T probably damaging Het
Kcmf1 T C 6: 72,850,484 I58V probably benign Het
Khdrbs2 A G 1: 32,467,775 I167V possibly damaging Het
Kmt2c A G 5: 25,299,252 I275T probably benign Het
Lingo4 A G 3: 94,403,081 K442R probably benign Het
Mak T C 13: 41,042,185 N382D probably benign Het
Maob G A X: 16,710,163 T480I possibly damaging Het
Mcoln1 A G 8: 3,515,025 E573G probably benign Het
Ms4a6b G A 19: 11,526,898 probably null Het
Muc5ac A G 7: 141,796,244 M576V probably benign Het
Nme8 T A 13: 19,690,859 D126V probably benign Het
Npy2r T A 3: 82,541,363 D35V possibly damaging Het
Nrxn1 T C 17: 90,362,857 D193G probably damaging Het
Olfr1257 T A 2: 89,881,591 V255E probably benign Het
Olfr130 A C 17: 38,067,240 E23A probably damaging Het
Olfr1391 T C 11: 49,327,756 L115P probably damaging Het
Olfr1537 G A 9: 39,237,650 T258M probably benign Het
Olfr214 A G 6: 116,556,928 I168V probably benign Het
Olfr548-ps1 T A 7: 102,542,554 M206K possibly damaging Het
Olfr895 G T 9: 38,269,334 V266L probably benign Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Olfr984 A T 9: 40,100,987 F168I probably damaging Het
Pabpc2 A T 18: 39,773,739 H19L possibly damaging Het
Pcdhb9 A T 18: 37,401,975 K341* probably null Het
Pde4dip T C 3: 97,747,533 I859M probably benign Het
Pfkfb2 T C 1: 130,706,422 probably null Het
Pigg C T 5: 108,314,085 T94M probably damaging Het
Pik3c2b T C 1: 133,100,831 F1353L probably damaging Het
Prg4 T C 1: 150,460,711 D87G probably damaging Het
Prkdc A T 16: 15,690,407 D974V probably damaging Het
Prmt3 A G 7: 49,787,328 Y217C probably damaging Het
Proser1 A G 3: 53,474,697 T192A probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Rb1cc1 A G 1: 6,244,262 K386R possibly damaging Het
Rcn2 A G 9: 56,056,250 D221G probably benign Het
Rhbdl3 T G 11: 80,331,861 H245Q probably damaging Het
Ribc1 T C X: 152,005,791 E204G probably damaging Het
Rpap1 G A 2: 119,778,120 L254F probably damaging Het
Rrp12 A G 19: 41,892,549 F148L possibly damaging Het
Setdb1 A T 3: 95,341,798 I333K probably damaging Het
Simc1 A G 13: 54,547,032 I1210V probably benign Het
Smchd1 T A 17: 71,379,574 D1379V probably benign Het
Snap29 A T 16: 17,422,506 K159* probably null Het
Spdye4c A T 2: 128,594,212 K176M possibly damaging Het
Stk31 T A 6: 49,423,485 W415R probably damaging Het
Supt6 C T 11: 78,209,495 R1497Q probably damaging Het
Tenm3 A G 8: 48,276,156 I1605T possibly damaging Het
Ttn T C 2: 76,846,623 probably null Het
Ttn A G 2: 76,897,667 probably benign Het
Ucp3 A T 7: 100,480,161 T68S probably benign Het
Ugt2b36 T C 5: 87,089,477 N316D probably benign Het
Usp4 T G 9: 108,366,804 S247A probably benign Het
Vmn1r183 A G 7: 24,054,825 I18V probably benign Het
Vmn1r237 A G 17: 21,314,623 M203V probably damaging Het
Vmn1r61 A T 7: 5,610,999 F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 C158R probably damaging Het
Zfyve16 C G 13: 92,521,129 R758P probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTCAGGGACAGCAACAGTACAAGTG -3'
(R):5'- CATCTGGAAGATCTGGGCAGCAAAG -3'

Sequencing Primer
(F):5'- TACCATGTGACTGTAAGGAGCATC -3'
(R):5'- AACTTACAGTGTCCGAGTCAG -3'
Posted On2013-07-11