Incidental Mutation 'R0617:Reln'
ID58409
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 038806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R0617 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21920537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2716 (D2716G)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: D2716G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: D2716G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159768
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: D2716G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: D2716G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik C A 19: 11,112,400 L40F probably damaging Het
4930555F03Rik A T 8: 49,500,492 noncoding transcript Het
A630073D07Rik T C 6: 132,626,737 probably benign Het
Abca16 G A 7: 120,433,611 probably benign Het
Abca5 A T 11: 110,279,689 D1265E probably damaging Het
Abcf1 C T 17: 35,961,187 V312I probably benign Het
Abhd12 T A 2: 150,846,365 probably null Het
Adam23 A G 1: 63,543,147 H318R probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Adgrf3 T C 5: 30,195,080 T972A probably benign Het
Adipoq T A 16: 23,155,410 D62E probably damaging Het
Akap2 T C 4: 57,829,434 probably benign Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Arap2 AT ATT 5: 62,649,907 probably benign Het
Arhgef28 G T 13: 97,970,355 T687K probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
Atad2b C A 12: 4,937,401 D76E probably benign Het
Atm A T 9: 53,458,941 Y2290* probably null Het
Atrn T A 2: 130,995,085 probably null Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Bsn T C 9: 108,107,240 E3205G unknown Het
Cacna1c T C 6: 118,602,213 Y1599C probably damaging Het
Ccdc40 A G 11: 119,242,804 D590G probably damaging Het
Ccdc68 A G 18: 69,946,552 probably null Het
Ccdc97 G A 7: 25,714,420 R279C probably damaging Het
Ccm2l A G 2: 153,070,900 T120A probably damaging Het
Cfap54 T C 10: 92,829,650 probably benign Het
Cfh A G 1: 140,100,883 S1043P probably benign Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Cib2 T C 9: 54,554,496 D26G possibly damaging Het
Col24a1 T C 3: 145,314,120 V84A probably damaging Het
Csn3 T C 5: 87,929,871 Y79H probably benign Het
Ddx47 T A 6: 135,017,122 V149E probably damaging Het
Dennd5b A T 6: 149,033,262 probably benign Het
Desi1 T C 15: 81,998,198 N109D probably damaging Het
Fam13c T C 10: 70,536,352 probably benign Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fanca A G 8: 123,288,070 F831S probably damaging Het
Fancm C T 12: 65,097,317 R518* probably null Het
Fat2 A G 11: 55,311,843 V135A possibly damaging Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Fgd3 A T 13: 49,264,697 V631E possibly damaging Het
Fhod3 G A 18: 25,112,679 probably benign Het
Focad T C 4: 88,121,288 probably benign Het
Foxn4 C A 5: 114,261,068 probably benign Het
Gm1673 T C 5: 33,983,552 probably benign Het
Gm2381 A T 7: 42,819,978 C241S probably damaging Het
Gm6483 T G 8: 19,693,709 F117V probably damaging Het
Hectd4 T C 5: 121,343,232 probably benign Het
Hecw1 T A 13: 14,280,442 Q676L probably benign Het
Hipk2 G A 6: 38,747,485 R437C possibly damaging Het
Ifnar1 T C 16: 91,501,682 Y396H probably damaging Het
Ints5 A T 19: 8,896,019 K447N probably damaging Het
Iqsec1 T C 6: 90,689,970 Y495C probably damaging Het
Itga5 C T 15: 103,356,315 probably null Het
Kcnk4 T A 19: 6,928,160 probably benign Het
Kmo A G 1: 175,647,190 T174A possibly damaging Het
Krt36 T C 11: 100,102,275 D458G probably damaging Het
Krtap16-1 G T 11: 99,986,495 P28T probably damaging Het
Lama3 T C 18: 12,419,258 probably null Het
Lrrc9 T C 12: 72,483,014 S920P probably damaging Het
Lrrk2 A T 15: 91,752,278 Y1485F probably benign Het
Mical1 C T 10: 41,481,315 A372V probably damaging Het
Mtr C T 13: 12,221,432 R636Q probably benign Het
Muc4 A T 16: 32,752,107 T662S possibly damaging Het
Myo10 G A 15: 25,738,005 V546M probably damaging Het
Nbeal1 G A 1: 60,281,832 W2034* probably null Het
Nhlrc3 T C 3: 53,458,623 T150A probably damaging Het
Nkx2-1 T C 12: 56,534,855 H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 noncoding transcript Het
Nod2 A G 8: 88,653,231 N120S probably benign Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1124 A G 2: 87,434,661 D58G probably damaging Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr1459 T C 19: 13,146,363 M99V probably benign Het
Olfr1477 C A 19: 13,502,536 N64K probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr640 A T 7: 104,021,989 S110T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pcdhb8 C T 18: 37,357,047 R593C probably benign Het
Pgm3 A G 9: 86,556,190 probably null Het
Pirt T A 11: 66,926,172 V103E probably damaging Het
Plxnc1 T A 10: 94,799,368 D1332V probably damaging Het
Ppfia4 A T 1: 134,328,780 V122E probably damaging Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prmt2 C T 10: 76,208,683 probably benign Het
Prrc2a G T 17: 35,153,560 P1702T probably damaging Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Rb1cc1 T A 1: 6,248,790 I794K possibly damaging Het
Sbf2 ACC AC 7: 110,330,683 probably null Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Setx T A 2: 29,146,807 H1101Q possibly damaging Het
Sis A G 3: 72,965,605 C67R probably damaging Het
Skint1 T A 4: 112,029,399 probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata31d1a A T 13: 59,702,259 I685N possibly damaging Het
Spef2 T A 15: 9,592,758 N1499I probably damaging Het
Stk11ip T A 1: 75,532,288 probably null Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Svil T C 18: 5,117,002 S2059P probably damaging Het
Syne1 C T 10: 5,350,933 V932M probably damaging Het
Tacc1 A C 8: 25,178,004 probably benign Het
Tbc1d13 C A 2: 30,135,564 probably benign Het
Tbc1d15 A C 10: 115,239,299 D59E probably damaging Het
Tcaf2 A G 6: 42,642,511 F194S probably damaging Het
Terf2ip T A 8: 112,011,495 M5K probably benign Het
Tgfbr2 A T 9: 116,158,320 D40E probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmprss3 A T 17: 31,193,912 C129S probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Tnr A G 1: 159,868,103 D532G probably damaging Het
Tnrc18 T A 5: 142,776,739 H465L unknown Het
Togaram2 A T 17: 71,700,509 Q350L possibly damaging Het
Topaz1 G A 9: 122,749,906 C627Y possibly damaging Het
Tpx2 A T 2: 152,873,138 Q93L probably benign Het
Trim54 T C 5: 31,136,182 probably null Het
Troap T A 15: 99,082,660 C574S probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r51 A G 7: 10,100,469 V214A possibly damaging Het
Vmn2r66 A T 7: 84,995,276 M642K probably benign Het
Vwa5a T A 9: 38,723,895 I232N probably damaging Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp820 A T 17: 21,819,704 S214R probably damaging Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Zgrf1 C T 3: 127,588,038 T1162M probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTATCCTTCTGGTGGCTCTGA -3'
(R):5'- TGGATAAATGGATGGATGTGTGGATGAC -3'

Sequencing Primer
(F):5'- GGCTCTGACCAGGTCGC -3'
(R):5'- acctgaactacaaagtgagacc -3'
Posted On2013-07-11