Incidental Mutation 'R0617:Abca16'
ID58432
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission 038806-MU
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0617 (G1)
Quality Score223
Status Validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 120433611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably benign
Transcript: ENSMUST00000056042
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik C A 19: 11,112,400 L40F probably damaging Het
4930555F03Rik A T 8: 49,500,492 noncoding transcript Het
A630073D07Rik T C 6: 132,626,737 probably benign Het
Abca5 A T 11: 110,279,689 D1265E probably damaging Het
Abcf1 C T 17: 35,961,187 V312I probably benign Het
Abhd12 T A 2: 150,846,365 probably null Het
Adam23 A G 1: 63,543,147 H318R probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Adgrf3 T C 5: 30,195,080 T972A probably benign Het
Adipoq T A 16: 23,155,410 D62E probably damaging Het
Akap2 T C 4: 57,829,434 probably benign Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Arap2 AT ATT 5: 62,649,907 probably benign Het
Arhgef28 G T 13: 97,970,355 T687K probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
Atad2b C A 12: 4,937,401 D76E probably benign Het
Atm A T 9: 53,458,941 Y2290* probably null Het
Atrn T A 2: 130,995,085 probably null Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Bsn T C 9: 108,107,240 E3205G unknown Het
Cacna1c T C 6: 118,602,213 Y1599C probably damaging Het
Ccdc40 A G 11: 119,242,804 D590G probably damaging Het
Ccdc68 A G 18: 69,946,552 probably null Het
Ccdc97 G A 7: 25,714,420 R279C probably damaging Het
Ccm2l A G 2: 153,070,900 T120A probably damaging Het
Cfap54 T C 10: 92,829,650 probably benign Het
Cfh A G 1: 140,100,883 S1043P probably benign Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Cib2 T C 9: 54,554,496 D26G possibly damaging Het
Col24a1 T C 3: 145,314,120 V84A probably damaging Het
Csn3 T C 5: 87,929,871 Y79H probably benign Het
Ddx47 T A 6: 135,017,122 V149E probably damaging Het
Dennd5b A T 6: 149,033,262 probably benign Het
Desi1 T C 15: 81,998,198 N109D probably damaging Het
Fam13c T C 10: 70,536,352 probably benign Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fanca A G 8: 123,288,070 F831S probably damaging Het
Fancm C T 12: 65,097,317 R518* probably null Het
Fat2 A G 11: 55,311,843 V135A possibly damaging Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Fgd3 A T 13: 49,264,697 V631E possibly damaging Het
Fhod3 G A 18: 25,112,679 probably benign Het
Focad T C 4: 88,121,288 probably benign Het
Foxn4 C A 5: 114,261,068 probably benign Het
Gm1673 T C 5: 33,983,552 probably benign Het
Gm2381 A T 7: 42,819,978 C241S probably damaging Het
Gm6483 T G 8: 19,693,709 F117V probably damaging Het
Hectd4 T C 5: 121,343,232 probably benign Het
Hecw1 T A 13: 14,280,442 Q676L probably benign Het
Hipk2 G A 6: 38,747,485 R437C possibly damaging Het
Ifnar1 T C 16: 91,501,682 Y396H probably damaging Het
Ints5 A T 19: 8,896,019 K447N probably damaging Het
Iqsec1 T C 6: 90,689,970 Y495C probably damaging Het
Itga5 C T 15: 103,356,315 probably null Het
Kcnk4 T A 19: 6,928,160 probably benign Het
Kmo A G 1: 175,647,190 T174A possibly damaging Het
Krt36 T C 11: 100,102,275 D458G probably damaging Het
Krtap16-1 G T 11: 99,986,495 P28T probably damaging Het
Lama3 T C 18: 12,419,258 probably null Het
Lrrc9 T C 12: 72,483,014 S920P probably damaging Het
Lrrk2 A T 15: 91,752,278 Y1485F probably benign Het
Mical1 C T 10: 41,481,315 A372V probably damaging Het
Mtr C T 13: 12,221,432 R636Q probably benign Het
Muc4 A T 16: 32,752,107 T662S possibly damaging Het
Myo10 G A 15: 25,738,005 V546M probably damaging Het
Nbeal1 G A 1: 60,281,832 W2034* probably null Het
Nhlrc3 T C 3: 53,458,623 T150A probably damaging Het
Nkx2-1 T C 12: 56,534,855 H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 noncoding transcript Het
Nod2 A G 8: 88,653,231 N120S probably benign Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1124 A G 2: 87,434,661 D58G probably damaging Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr1459 T C 19: 13,146,363 M99V probably benign Het
Olfr1477 C A 19: 13,502,536 N64K probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr640 A T 7: 104,021,989 S110T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pcdhb8 C T 18: 37,357,047 R593C probably benign Het
Pgm3 A G 9: 86,556,190 probably null Het
Pirt T A 11: 66,926,172 V103E probably damaging Het
Plxnc1 T A 10: 94,799,368 D1332V probably damaging Het
Ppfia4 A T 1: 134,328,780 V122E probably damaging Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prmt2 C T 10: 76,208,683 probably benign Het
Prrc2a G T 17: 35,153,560 P1702T probably damaging Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Rb1cc1 T A 1: 6,248,790 I794K possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Sbf2 ACC AC 7: 110,330,683 probably null Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Setx T A 2: 29,146,807 H1101Q possibly damaging Het
Sis A G 3: 72,965,605 C67R probably damaging Het
Skint1 T A 4: 112,029,399 probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata31d1a A T 13: 59,702,259 I685N possibly damaging Het
Spef2 T A 15: 9,592,758 N1499I probably damaging Het
Stk11ip T A 1: 75,532,288 probably null Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Svil T C 18: 5,117,002 S2059P probably damaging Het
Syne1 C T 10: 5,350,933 V932M probably damaging Het
Tacc1 A C 8: 25,178,004 probably benign Het
Tbc1d13 C A 2: 30,135,564 probably benign Het
Tbc1d15 A C 10: 115,239,299 D59E probably damaging Het
Tcaf2 A G 6: 42,642,511 F194S probably damaging Het
Terf2ip T A 8: 112,011,495 M5K probably benign Het
Tgfbr2 A T 9: 116,158,320 D40E probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmprss3 A T 17: 31,193,912 C129S probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Tnr A G 1: 159,868,103 D532G probably damaging Het
Tnrc18 T A 5: 142,776,739 H465L unknown Het
Togaram2 A T 17: 71,700,509 Q350L possibly damaging Het
Topaz1 G A 9: 122,749,906 C627Y possibly damaging Het
Tpx2 A T 2: 152,873,138 Q93L probably benign Het
Trim54 T C 5: 31,136,182 probably null Het
Troap T A 15: 99,082,660 C574S probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r51 A G 7: 10,100,469 V214A possibly damaging Het
Vmn2r66 A T 7: 84,995,276 M642K probably benign Het
Vwa5a T A 9: 38,723,895 I232N probably damaging Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp820 A T 17: 21,819,704 S214R probably damaging Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Zgrf1 C T 3: 127,588,038 T1162M probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGACAAGAGCATCATGCTG -3'
(R):5'- GCTCTGCTGGAAGGTGACCAATATC -3'

Sequencing Primer
(F):5'- TGCTGTATCATGAAAGCAGTGC -3'
(R):5'- GGTGACCAATATCCAGCAATG -3'
Protein Function and Prediction

Abca16 encodes ABCA16, a member of the ATP-binding cassette (ABC) transporter superfamily.  The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. Abca16 has been cloned rat and mouse; no human orthologue has been described. The ABCA16 has two nucleotide-binding folds and two transmembrane domains.  Abca16 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis. 

Posted On2013-07-11