Incidental Mutation 'R0617:Smg6'
ID58457
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 038806-MU
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0617 (G1)
Quality Score193
Status Validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75162931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1413 (T1413K)
Ref Sequence ENSEMBL: ENSMUSP00000043555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
Predicted Effect probably benign
Transcript: ENSMUST00000045281
AA Change: T1413K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: T1413K

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055619
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153226
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik C A 19: 11,112,400 L40F probably damaging Het
4930555F03Rik A T 8: 49,500,492 noncoding transcript Het
A630073D07Rik T C 6: 132,626,737 probably benign Het
Abca16 G A 7: 120,433,611 probably benign Het
Abca5 A T 11: 110,279,689 D1265E probably damaging Het
Abcf1 C T 17: 35,961,187 V312I probably benign Het
Abhd12 T A 2: 150,846,365 probably null Het
Adam23 A G 1: 63,543,147 H318R probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Adgrf3 T C 5: 30,195,080 T972A probably benign Het
Adipoq T A 16: 23,155,410 D62E probably damaging Het
Akap2 T C 4: 57,829,434 probably benign Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Arap2 AT ATT 5: 62,649,907 probably benign Het
Arhgef28 G T 13: 97,970,355 T687K probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
Atad2b C A 12: 4,937,401 D76E probably benign Het
Atm A T 9: 53,458,941 Y2290* probably null Het
Atrn T A 2: 130,995,085 probably null Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Bsn T C 9: 108,107,240 E3205G unknown Het
Cacna1c T C 6: 118,602,213 Y1599C probably damaging Het
Ccdc40 A G 11: 119,242,804 D590G probably damaging Het
Ccdc68 A G 18: 69,946,552 probably null Het
Ccdc97 G A 7: 25,714,420 R279C probably damaging Het
Ccm2l A G 2: 153,070,900 T120A probably damaging Het
Cfap54 T C 10: 92,829,650 probably benign Het
Cfh A G 1: 140,100,883 S1043P probably benign Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Cib2 T C 9: 54,554,496 D26G possibly damaging Het
Col24a1 T C 3: 145,314,120 V84A probably damaging Het
Csn3 T C 5: 87,929,871 Y79H probably benign Het
Ddx47 T A 6: 135,017,122 V149E probably damaging Het
Dennd5b A T 6: 149,033,262 probably benign Het
Desi1 T C 15: 81,998,198 N109D probably damaging Het
Fam13c T C 10: 70,536,352 probably benign Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fanca A G 8: 123,288,070 F831S probably damaging Het
Fancm C T 12: 65,097,317 R518* probably null Het
Fat2 A G 11: 55,311,843 V135A possibly damaging Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Fgd3 A T 13: 49,264,697 V631E possibly damaging Het
Fhod3 G A 18: 25,112,679 probably benign Het
Focad T C 4: 88,121,288 probably benign Het
Foxn4 C A 5: 114,261,068 probably benign Het
Gm1673 T C 5: 33,983,552 probably benign Het
Gm2381 A T 7: 42,819,978 C241S probably damaging Het
Gm6483 T G 8: 19,693,709 F117V probably damaging Het
Hectd4 T C 5: 121,343,232 probably benign Het
Hecw1 T A 13: 14,280,442 Q676L probably benign Het
Hipk2 G A 6: 38,747,485 R437C possibly damaging Het
Ifnar1 T C 16: 91,501,682 Y396H probably damaging Het
Ints5 A T 19: 8,896,019 K447N probably damaging Het
Iqsec1 T C 6: 90,689,970 Y495C probably damaging Het
Itga5 C T 15: 103,356,315 probably null Het
Kcnk4 T A 19: 6,928,160 probably benign Het
Kmo A G 1: 175,647,190 T174A possibly damaging Het
Krt36 T C 11: 100,102,275 D458G probably damaging Het
Krtap16-1 G T 11: 99,986,495 P28T probably damaging Het
Lama3 T C 18: 12,419,258 probably null Het
Lrrc9 T C 12: 72,483,014 S920P probably damaging Het
Lrrk2 A T 15: 91,752,278 Y1485F probably benign Het
Mical1 C T 10: 41,481,315 A372V probably damaging Het
Mtr C T 13: 12,221,432 R636Q probably benign Het
Muc4 A T 16: 32,752,107 T662S possibly damaging Het
Myo10 G A 15: 25,738,005 V546M probably damaging Het
Nbeal1 G A 1: 60,281,832 W2034* probably null Het
Nhlrc3 T C 3: 53,458,623 T150A probably damaging Het
Nkx2-1 T C 12: 56,534,855 H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 noncoding transcript Het
Nod2 A G 8: 88,653,231 N120S probably benign Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1124 A G 2: 87,434,661 D58G probably damaging Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr1459 T C 19: 13,146,363 M99V probably benign Het
Olfr1477 C A 19: 13,502,536 N64K probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr640 A T 7: 104,021,989 S110T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pcdhb8 C T 18: 37,357,047 R593C probably benign Het
Pgm3 A G 9: 86,556,190 probably null Het
Pirt T A 11: 66,926,172 V103E probably damaging Het
Plxnc1 T A 10: 94,799,368 D1332V probably damaging Het
Ppfia4 A T 1: 134,328,780 V122E probably damaging Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prmt2 C T 10: 76,208,683 probably benign Het
Prrc2a G T 17: 35,153,560 P1702T probably damaging Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Rb1cc1 T A 1: 6,248,790 I794K possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Sbf2 ACC AC 7: 110,330,683 probably null Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Setx T A 2: 29,146,807 H1101Q possibly damaging Het
Sis A G 3: 72,965,605 C67R probably damaging Het
Skint1 T A 4: 112,029,399 probably benign Het
Spata31d1a A T 13: 59,702,259 I685N possibly damaging Het
Spef2 T A 15: 9,592,758 N1499I probably damaging Het
Stk11ip T A 1: 75,532,288 probably null Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Svil T C 18: 5,117,002 S2059P probably damaging Het
Syne1 C T 10: 5,350,933 V932M probably damaging Het
Tacc1 A C 8: 25,178,004 probably benign Het
Tbc1d13 C A 2: 30,135,564 probably benign Het
Tbc1d15 A C 10: 115,239,299 D59E probably damaging Het
Tcaf2 A G 6: 42,642,511 F194S probably damaging Het
Terf2ip T A 8: 112,011,495 M5K probably benign Het
Tgfbr2 A T 9: 116,158,320 D40E probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmprss3 A T 17: 31,193,912 C129S probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Tnr A G 1: 159,868,103 D532G probably damaging Het
Tnrc18 T A 5: 142,776,739 H465L unknown Het
Togaram2 A T 17: 71,700,509 Q350L possibly damaging Het
Topaz1 G A 9: 122,749,906 C627Y possibly damaging Het
Tpx2 A T 2: 152,873,138 Q93L probably benign Het
Trim54 T C 5: 31,136,182 probably null Het
Troap T A 15: 99,082,660 C574S probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r51 A G 7: 10,100,469 V214A possibly damaging Het
Vmn2r66 A T 7: 84,995,276 M642K probably benign Het
Vwa5a T A 9: 38,723,895 I232N probably damaging Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp820 A T 17: 21,819,704 S214R probably damaging Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Zgrf1 C T 3: 127,588,038 T1162M probably benign Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
PIT4802001:Smg6 UTSW 11 75156165 missense probably damaging 0.96
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1780:Smg6 UTSW 11 74946116 missense probably damaging 1.00
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R2513:Smg6 UTSW 11 74929676 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5725:Smg6 UTSW 11 74930613 missense probably benign 0.45
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6349:Smg6 UTSW 11 75053774 missense possibly damaging 0.94
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6619:Smg6 UTSW 11 74932453 critical splice donor site probably null
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGAGCCTGGAAAGAACTTGCCC -3'
(R):5'- CACCTGTTGTCACTGTAGCCAGTC -3'

Sequencing Primer
(F):5'- TTCTCCCCAAGACAGGAGATTG -3'
(R):5'- TAAATCTTGGCAGCCCAGGAG -3'
Posted On2013-07-11