Incidental Mutation 'R7557:Add3'
ID 584863
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Name adducin 3
Synonyms
MMRRC Submission 045652-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7557 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 53128874-53235518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53227868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 518 (T518A)
Ref Sequence ENSEMBL: ENSMUSP00000025999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
AlphaFold Q9QYB5
Predicted Effect probably damaging
Transcript: ENSMUST00000025999
AA Change: T518A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: T518A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050096
AA Change: T518A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: T518A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111741
AA Change: T518A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: T518A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,044 (GRCm39) Q1078* probably null Het
Aatk T C 11: 119,900,256 (GRCm39) K1310R possibly damaging Het
Acaa2 C T 18: 74,928,230 (GRCm39) T153M possibly damaging Het
Cacnb4 T C 2: 52,359,579 (GRCm39) E143G probably damaging Het
Cd209a T A 8: 3,795,541 (GRCm39) T177S probably benign Het
Chp1 T A 2: 119,391,238 (GRCm39) Y32N probably damaging Het
Clcn3 T C 8: 61,390,402 (GRCm39) T180A probably damaging Het
Dctn2 C A 10: 127,114,273 (GRCm39) T373N probably benign Het
Dipk2a T C 9: 94,402,591 (GRCm39) D357G probably damaging Het
Ecpas A G 4: 58,849,691 (GRCm39) Y483H possibly damaging Het
Emb T A 13: 117,386,252 (GRCm39) N136K probably benign Het
Enpp2 A T 15: 54,773,536 (GRCm39) C62S probably damaging Het
Fbxo28 G T 1: 182,169,000 (GRCm39) A52E unknown Het
Gask1b A T 3: 79,793,915 (GRCm39) K128* probably null Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Ggta1 T C 2: 35,292,548 (GRCm39) D253G probably damaging Het
Gps1 C T 11: 120,677,193 (GRCm39) A164V probably benign Het
Gramd4 C T 15: 85,985,101 (GRCm39) Q146* probably null Het
Kcnh5 A T 12: 75,054,399 (GRCm39) M515K possibly damaging Het
Klrc3 T C 6: 129,616,107 (GRCm39) T203A probably damaging Het
Krt26 G T 11: 99,225,567 (GRCm39) R305S probably damaging Het
Lpin1 A G 12: 16,630,793 (GRCm39) V35A Het
Marf1 C T 16: 13,950,560 (GRCm39) R942H probably damaging Het
Mfhas1 T A 8: 36,056,758 (GRCm39) M411K possibly damaging Het
Mok A G 12: 110,774,833 (GRCm39) S330P probably benign Het
Msto1 A G 3: 88,817,435 (GRCm39) probably null Het
Omg T A 11: 79,393,679 (GRCm39) I60F possibly damaging Het
Or10w1 T A 19: 13,632,390 (GRCm39) I199N possibly damaging Het
Pcdhgb4 T A 18: 37,855,847 (GRCm39) C747* probably null Het
Pih1d1 A G 7: 44,806,183 (GRCm39) T40A probably benign Het
Pih1d2 A T 9: 50,536,216 (GRCm39) E290D probably damaging Het
Plce1 A G 19: 38,753,848 (GRCm39) K1849E probably benign Het
Plekha5 T C 6: 140,372,271 (GRCm39) Y74H probably damaging Het
Pole T G 5: 110,460,860 (GRCm39) I1183S probably damaging Het
Ptgs1 T C 2: 36,135,223 (GRCm39) S396P possibly damaging Het
Rasa2 T C 9: 96,439,478 (GRCm39) E575G probably damaging Het
Sec22b A G 3: 97,808,674 (GRCm39) T5A probably damaging Het
Slc18a1 T A 8: 69,518,213 (GRCm39) D267V probably damaging Het
Smad5 T C 13: 56,875,282 (GRCm39) F157L probably benign Het
Tcea1 T A 1: 4,965,213 (GRCm39) C294* probably null Het
Tut7 T C 13: 59,936,280 (GRCm39) I1274V possibly damaging Het
Txndc15 T A 13: 55,865,767 (GRCm39) M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r1 T A 3: 63,997,475 (GRCm39) V377D probably damaging Het
Vmn2r7 A G 3: 64,632,394 (GRCm39) Y23H probably benign Het
Vwa3a T A 7: 120,394,841 (GRCm39) M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 (GRCm39) N63D probably damaging Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53,227,861 (GRCm39) missense probably damaging 1.00
IGL02177:Add3 APN 19 53,205,323 (GRCm39) nonsense probably null
IGL03093:Add3 APN 19 53,219,638 (GRCm39) missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53,231,022 (GRCm39) missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53,225,121 (GRCm39) missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53,205,298 (GRCm39) missense unknown
R0087:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R0335:Add3 UTSW 19 53,225,259 (GRCm39) missense probably benign 0.00
R0346:Add3 UTSW 19 53,205,387 (GRCm39) nonsense probably null
R0514:Add3 UTSW 19 53,225,274 (GRCm39) nonsense probably null
R0692:Add3 UTSW 19 53,205,383 (GRCm39) missense probably damaging 1.00
R1437:Add3 UTSW 19 53,222,109 (GRCm39) missense probably damaging 0.98
R1747:Add3 UTSW 19 53,230,981 (GRCm39) missense probably benign 0.41
R2926:Add3 UTSW 19 53,215,253 (GRCm39) splice site probably null
R4192:Add3 UTSW 19 53,230,955 (GRCm39) missense probably benign 0.00
R4780:Add3 UTSW 19 53,223,223 (GRCm39) missense possibly damaging 0.64
R5019:Add3 UTSW 19 53,231,002 (GRCm39) missense probably damaging 0.99
R5486:Add3 UTSW 19 53,232,818 (GRCm39) missense probably benign 0.00
R5526:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R5580:Add3 UTSW 19 53,233,642 (GRCm39) missense probably damaging 1.00
R5851:Add3 UTSW 19 53,225,205 (GRCm39) missense probably damaging 1.00
R5863:Add3 UTSW 19 53,222,301 (GRCm39) missense probably benign 0.00
R5951:Add3 UTSW 19 53,232,720 (GRCm39) splice site probably null
R6229:Add3 UTSW 19 53,223,277 (GRCm39) missense probably benign 0.35
R7017:Add3 UTSW 19 53,222,284 (GRCm39) missense possibly damaging 0.94
R7190:Add3 UTSW 19 53,205,330 (GRCm39) nonsense probably null
R7222:Add3 UTSW 19 53,205,277 (GRCm39) missense unknown
R7231:Add3 UTSW 19 53,221,577 (GRCm39) missense probably benign 0.00
R7532:Add3 UTSW 19 53,220,589 (GRCm39) missense probably damaging 1.00
R7726:Add3 UTSW 19 53,227,892 (GRCm39) missense probably damaging 1.00
R9063:Add3 UTSW 19 53,222,302 (GRCm39) missense probably damaging 0.98
R9069:Add3 UTSW 19 53,222,332 (GRCm39) missense possibly damaging 0.92
R9371:Add3 UTSW 19 53,221,499 (GRCm39) missense probably damaging 1.00
R9550:Add3 UTSW 19 53,233,521 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGATTAGTGCCAGCTAGCGTTC -3'
(R):5'- CACTGGGATGAAATGTGGCATC -3'

Sequencing Primer
(F):5'- AGTGCCAGCTAGCGTTCAGATG -3'
(R):5'- AAATGTGGCATCTAAGTTTTATGGG -3'
Posted On 2019-10-17