Incidental Mutation 'R0619:Ccdc18'
ID58525
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108180416 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 661 (K661E)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: K661E

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: K661E

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGAAAGCAGAAAGAGATCGGCatataa -3'
(R):5'- agtggggaaaagcctcCAGTATACa -3'

Sequencing Primer
(F):5'- ATGTTTAAAGTGTTCTCAGTGCTTTT -3'
(R):5'- GCTGTTTACACAGTATATCTTGCTGC -3'
Posted On2013-07-11