Incidental Mutation 'R0622:Ralgps1'
ID58705
Institutional Source Beutler Lab
Gene Symbol Ralgps1
Ensembl Gene ENSMUSG00000038831
Gene NameRal GEF with PH domain and SH3 binding motif 1
SynonymsRALGPS1A, 5830418G11Rik, RALGEF2
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R0622 (G1)
Quality Score206
Status Not validated
Chromosome2
Chromosomal Location33133417-33371486 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 33174447 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 238 (R238*)
Ref Sequence ENSEMBL: ENSMUSP00000118363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298]
Predicted Effect probably null
Transcript: ENSMUST00000042615
AA Change: R221*
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831
AA Change: R221*

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091039
AA Change: R238*
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831
AA Change: R238*

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113165
AA Change: R238*
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831
AA Change: R238*

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131298
AA Change: R238*
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831
AA Change: R238*

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139288
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype NO_PHENOTYPE,When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls.
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Ralgps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ralgps1 APN 2 33137682 makesense probably null
IGL00780:Ralgps1 APN 2 33273627 missense probably damaging 1.00
IGL00951:Ralgps1 APN 2 33273602 missense probably damaging 1.00
IGL01358:Ralgps1 APN 2 33143049 missense possibly damaging 0.62
IGL02346:Ralgps1 APN 2 33157770 critical splice donor site probably null
IGL02481:Ralgps1 APN 2 33340729 missense probably benign 0.04
IGL03281:Ralgps1 APN 2 33172416 critical splice donor site probably null
IGL03284:Ralgps1 APN 2 33146565 splice site probably benign
IGL03377:Ralgps1 APN 2 33172461 missense probably damaging 1.00
R0007:Ralgps1 UTSW 2 33143389 missense probably damaging 0.97
R0029:Ralgps1 UTSW 2 33141019 missense probably benign
R0309:Ralgps1 UTSW 2 33157923 missense probably benign
R0320:Ralgps1 UTSW 2 33141015 missense possibly damaging 0.59
R1277:Ralgps1 UTSW 2 33174425 missense possibly damaging 0.51
R1797:Ralgps1 UTSW 2 33340711 critical splice donor site probably null
R2921:Ralgps1 UTSW 2 33143070 missense probably damaging 0.99
R3123:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R3124:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R4741:Ralgps1 UTSW 2 33336587 missense probably benign 0.00
R4894:Ralgps1 UTSW 2 33143103 missense possibly damaging 0.71
R5148:Ralgps1 UTSW 2 33158987 missense probably damaging 1.00
R5255:Ralgps1 UTSW 2 33276159 missense probably damaging 1.00
R5877:Ralgps1 UTSW 2 33243628 unclassified probably benign
R6330:Ralgps1 UTSW 2 33174443 missense probably damaging 1.00
R6908:Ralgps1 UTSW 2 33143100 missense probably benign 0.17
R7252:Ralgps1 UTSW 2 33168188 missense probably benign 0.12
R7299:Ralgps1 UTSW 2 33157873 missense probably benign
R7366:Ralgps1 UTSW 2 33324688 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGACGTGCCACTCACTAGACAATC -3'
(R):5'- TTTATGCCTTCGTGCCCAGGAGAC -3'

Sequencing Primer
(F):5'- CAAGTTGTTCCGCATGTACCTAAG -3'
(R):5'- TGCCCAGGAGACTGTTTAAC -3'
Posted On2013-07-11