Incidental Mutation 'R0622:Dhdds'
ID58720
Institutional Source Beutler Lab
Gene Symbol Dhdds
Ensembl Gene ENSMUSG00000012117
Gene Namedehydrodolichyl diphosphate synthase
Synonyms
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0622 (G1)
Quality Score179
Status Not validated
Chromosome4
Chromosomal Location133969028-134000918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 133994236 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 83 (F83L)
Ref Sequence ENSEMBL: ENSMUSP00000101510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012262] [ENSMUST00000105885] [ENSMUST00000105886] [ENSMUST00000105887] [ENSMUST00000105889] [ENSMUST00000130464] [ENSMUST00000144668]
Predicted Effect probably damaging
Transcript: ENSMUST00000012262
AA Change: F83L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012262
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105885
AA Change: F83L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101509
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 149 5.2e-42 PFAM
Pfam:Prenyltransf 145 222 1.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105886
AA Change: F83L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101510
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 109 9.8e-32 PFAM
Pfam:Prenyltransf 104 217 6.2e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105887
AA Change: F83L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101511
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 255 6.4e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105889
AA Change: F83L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101512
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 5.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130464
SMART Domains Protein: ENSMUSP00000121656
Gene: ENSMUSG00000012117

DomainStartEndE-ValueType
Pfam:Prenyltransf 1 54 1.8e-8 PFAM
Pfam:Prenyltransf 50 99 2.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142660
Predicted Effect probably damaging
Transcript: ENSMUST00000144668
AA Change: F83L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116098
Gene: ENSMUSG00000012117
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150729
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Dhdds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Dhdds APN 4 134000260 splice site probably benign
IGL01566:Dhdds APN 4 133991337 missense probably damaging 0.99
IGL03024:Dhdds APN 4 133982849 missense probably damaging 1.00
IGL03115:Dhdds APN 4 133982871 missense probably benign
LCD18:Dhdds UTSW 4 133970363 utr 3 prime probably benign
R2036:Dhdds UTSW 4 133971099 missense probably damaging 1.00
R5284:Dhdds UTSW 4 133980212 missense probably benign 0.06
R5444:Dhdds UTSW 4 133971136 nonsense probably null
R5780:Dhdds UTSW 4 133996830 missense probably damaging 1.00
R5781:Dhdds UTSW 4 133996830 missense probably damaging 1.00
R6723:Dhdds UTSW 4 133994265 missense probably damaging 1.00
R7362:Dhdds UTSW 4 133971130 missense probably benign 0.04
R7496:Dhdds UTSW 4 133971254 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGAACGCTCATGCTACGACAC -3'
(R):5'- GCGAACAGAAGTGCTAAAGTTGCCC -3'

Sequencing Primer
(F):5'- cctggaggagcgaggac -3'
(R):5'- GCTAAAGTTGCCCTTGCTTTAC -3'
Posted On2013-07-11