Incidental Mutation 'R0622:Pou2f3'
ID58736
Institutional Source Beutler Lab
Gene Symbol Pou2f3
Ensembl Gene ENSMUSG00000032015
Gene NamePOU domain, class 2, transcription factor 3
SynonymsOtf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0622 (G1)
Quality Score184
Status Not validated
Chromosome9
Chromosomal Location43123939-43210369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43125119 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 423 (R423H)
Ref Sequence ENSEMBL: ENSMUSP00000135115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]
Predicted Effect probably damaging
Transcript: ENSMUST00000034513
AA Change: R411H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: R411H

DomainStartEndE-ValueType
low complexity region 107 122 N/A INTRINSIC
low complexity region 150 162 N/A INTRINSIC
POU 164 238 1.47e-53 SMART
low complexity region 239 256 N/A INTRINSIC
HOX 262 324 8.39e-20 SMART
low complexity region 337 352 N/A INTRINSIC
low complexity region 362 378 N/A INTRINSIC
low complexity region 386 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176636
AA Change: R423H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: R423H

DomainStartEndE-ValueType
low complexity region 119 134 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
POU 176 250 1.47e-53 SMART
low complexity region 251 268 N/A INTRINSIC
HOX 274 336 8.39e-20 SMART
low complexity region 349 364 N/A INTRINSIC
low complexity region 374 390 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213862
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Pou2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pou2f3 APN 9 43128893 missense probably damaging 1.00
IGL00508:Pou2f3 APN 9 43139963 missense probably benign 0.01
IGL00975:Pou2f3 APN 9 43137384 missense probably benign
IGL01577:Pou2f3 APN 9 43146881 nonsense probably null
IGL01871:Pou2f3 APN 9 43134473 splice site probably benign
IGL02370:Pou2f3 APN 9 43137348 missense probably damaging 1.00
IGL02674:Pou2f3 APN 9 43139333 missense probably damaging 1.00
IGL02746:Pou2f3 APN 9 43146846 missense probably benign 0.01
IGL02956:Pou2f3 APN 9 43142805 splice site probably benign
IGL02962:Pou2f3 APN 9 43125089 utr 3 prime probably benign
IGL03082:Pou2f3 APN 9 43146915 critical splice acceptor site probably null
R0433:Pou2f3 UTSW 9 43127398 missense probably benign 0.23
R0926:Pou2f3 UTSW 9 43146901 missense probably damaging 1.00
R1956:Pou2f3 UTSW 9 43145237 missense probably benign
R4782:Pou2f3 UTSW 9 43139858 missense probably damaging 0.97
R4877:Pou2f3 UTSW 9 43139323 missense possibly damaging 0.58
R5070:Pou2f3 UTSW 9 43145281 missense possibly damaging 0.52
R5910:Pou2f3 UTSW 9 43134474 splice site probably null
R6280:Pou2f3 UTSW 9 43139339 missense probably damaging 1.00
R6280:Pou2f3 UTSW 9 43139340 missense probably damaging 1.00
R6465:Pou2f3 UTSW 9 43139867 missense probably damaging 1.00
R7084:Pou2f3 UTSW 9 43128893 missense probably damaging 1.00
R7161:Pou2f3 UTSW 9 43139363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGTTAGGTTCTCCGAAAGC -3'
(R):5'- GCACTTGAGATGAATCCACTCGTCC -3'

Sequencing Primer
(F):5'- AGGTTCTCCGAAAGCTCTGG -3'
(R):5'- ggtgaagagacccaaataatttcag -3'
Posted On2013-07-11