Incidental Mutation 'R0622:Klhl29'
ID58742
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Namekelch-like 29
SynonymsA230106N14Rik, Kbtbd9
MMRRC Submission 038811-MU
Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location5077472-5375682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5081224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 852 (L852P)
Ref Sequence ENSEMBL: ENSMUSP00000020958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
Predicted Effect probably damaging
Transcript: ENSMUST00000020958
AA Change: L852P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: L852P

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218384
AA Change: L791P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5140705 missense probably benign 0.01
IGL02639:Klhl29 APN 12 5137453 missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5137603 missense probably damaging 1.00
bauxite UTSW 12 5091347 missense probably damaging 0.98
mineral UTSW 12 5083995 missense probably damaging 0.99
tungsten UTSW 12 5090995 nonsense probably null
N/A - 535:Klhl29 UTSW 12 5084019 missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5084354 missense probably damaging 0.97
R0631:Klhl29 UTSW 12 5094883 missense probably benign 0.08
R0784:Klhl29 UTSW 12 5081251 missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5090650 missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5091307 missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5084486 missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5093538 missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5137876 missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5091350 missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5084036 missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5090603 missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5140660 missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5091334 missense probably benign 0.05
R5078:Klhl29 UTSW 12 5093530 missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5091366 missense probably benign 0.36
R5619:Klhl29 UTSW 12 5140587 missense probably benign 0.23
R5681:Klhl29 UTSW 12 5090669 missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5090995 nonsense probably null
R6294:Klhl29 UTSW 12 5083995 missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5094830 nonsense probably null
R6394:Klhl29 UTSW 12 5137720 missense probably benign 0.00
R6475:Klhl29 UTSW 12 5091030 missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5210124 missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5091347 missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5084393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACCCAAAAGGCGAGGATG -3'
(R):5'- GAGATTCACGGCCTAACTCTCTGC -3'

Sequencing Primer
(F):5'- CCAAAAGGCGAGGATGATTTTCTAC -3'
(R):5'- AACTCTCTGCCCCCTCC -3'
Posted On2013-07-11